ID: 929252350

View in Genome Browser
Species Human (GRCh38)
Location 2:39772822-39772844
Sequence CATGGGTACTTGAACTCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929252344_929252350 2 Left 929252344 2:39772797-39772819 CCTGTGTGTTAAGGCAGCTACCA 0: 1
1: 0
2: 2
3: 11
4: 118
Right 929252350 2:39772822-39772844 CATGGGTACTTGAACTCCAAGGG 0: 1
1: 0
2: 0
3: 5
4: 89
929252342_929252350 20 Left 929252342 2:39772779-39772801 CCAGGGAATGTGGGGTTTCCTGT 0: 1
1: 0
2: 3
3: 59
4: 271
Right 929252350 2:39772822-39772844 CATGGGTACTTGAACTCCAAGGG 0: 1
1: 0
2: 0
3: 5
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929252350 Original CRISPR CATGGGTACTTGAACTCCAA GGG Intronic
901248435 1:7752705-7752727 CATGGTTACCAGCACTCCAAGGG - Intronic
905442932 1:38006011-38006033 CATAGGGCCTTGACCTCCAAAGG + Intergenic
905608662 1:39328523-39328545 CATTTGTGCTTAAACTCCAAAGG - Intronic
913173598 1:116254216-116254238 CAGTTGTGCTTGAACTCCAAAGG - Intergenic
917298626 1:173549399-173549421 CATGGGAATTTTAAATCCAAGGG - Intronic
919182903 1:194108217-194108239 CATGTGTTCTTTATCTCCAAAGG - Intergenic
922603181 1:226872016-226872038 CATGGGCACTTCAACACCAAAGG - Intronic
922683650 1:227621835-227621857 CAGTGGTACCTAAACTCCAAAGG - Intronic
1067563453 10:47320192-47320214 CATGGGTAAATTAAGTCCAAAGG - Intergenic
1068904613 10:62309119-62309141 CAGGGATCCTTGAACTCCAAGGG + Intergenic
1071218247 10:83432709-83432731 GAAAGGTACTTGAACTCCAGTGG + Intergenic
1073834730 10:107428271-107428293 CATGTGTACTTAAAATCCAAAGG + Intergenic
1077539263 11:3139003-3139025 CAGGGGCACCTGAGCTCCAAGGG + Intronic
1088835552 11:113575466-113575488 CATGCTTGCTTGAACTCCACTGG - Intergenic
1092826649 12:12406454-12406476 CATGGGTTCCTTAGCTCCAATGG - Intronic
1093661867 12:21766575-21766597 AATGGTAACTTGAACTTCAATGG + Exonic
1093812221 12:23504855-23504877 CAGCTGTGCTTGAACTCCAAAGG - Intergenic
1095619145 12:44228255-44228277 CATGGTGACTTGAACTATAAAGG + Intronic
1095992089 12:48042155-48042177 CTTGGGTATGTGAACTCCCAGGG + Intergenic
1113583305 13:111444637-111444659 CATGGGGACAGGAAGTCCAATGG - Intergenic
1117100540 14:52342064-52342086 CATGTGTACTTGATTTTCAAAGG - Intergenic
1120733762 14:88030985-88031007 CATGGGAACCTGAACTTCATTGG + Intergenic
1124848455 15:33312995-33313017 CCTGGGTCCTTGAACCCCACAGG - Intronic
1127857458 15:62964236-62964258 CATGGACACTTGCACTCCAATGG - Intergenic
1129271053 15:74419428-74419450 CCTGGGAACCTGGACTCCAAGGG - Intronic
1131899104 15:97068210-97068232 TATGGGTATTTGAATACCAATGG - Intergenic
1134537221 16:15035622-15035644 TCTGGGTTCTTGAACTCCAGAGG + Intronic
1137339387 16:47585035-47585057 CATGGGGACTTGAGTTCCAGTGG - Intronic
1138215919 16:55205215-55205237 AATGGGTGCTTGAACGTCAAGGG - Intergenic
1138776384 16:59729005-59729027 CATGGACACTTGAACTCTCAGGG + Intronic
1139099052 16:63743808-63743830 CATGGATACTTGAGCTCACAAGG + Intergenic
1143389864 17:6553882-6553904 GATGGGTTCCTGATCTCCAAGGG + Intronic
1147645688 17:42032460-42032482 CATGGGAACATGAATTACAAGGG + Intronic
1148449855 17:47769937-47769959 GATGGGCACTTGATCTACAACGG - Intergenic
1151853941 17:76708770-76708792 CCTGGGGACTTGAACCCAAAGGG + Intronic
1155385872 18:25276544-25276566 AATGGATACTTGGACACCAAAGG + Intronic
1156988462 18:43377508-43377530 GTTGTGTGCTTGAACTCCAAAGG - Intergenic
1158267924 18:55680638-55680660 CATTGGGCCTTGAAATCCAAGGG + Intergenic
1164847469 19:31446463-31446485 AATAGGTACTTAAACACCAATGG + Intergenic
1165096910 19:33414402-33414424 CATGGATCTTTGAGCTCCAAGGG + Intronic
1168582315 19:57565893-57565915 TATGGGAACTTGAACTCTAGTGG + Intergenic
925468647 2:4135159-4135181 CAGAGGCCCTTGAACTCCAAGGG - Intergenic
929252350 2:39772822-39772844 CATGGGTACTTGAACTCCAAGGG + Intronic
948366897 2:237461610-237461632 CAGGGGTAGTGGAACTCCCAGGG - Intergenic
1170892528 20:20388321-20388343 CATGGTTATTTGAAATTCAAAGG - Intergenic
1182038394 22:27217163-27217185 AGTGGGCACTTGGACTCCAATGG + Intergenic
1183160846 22:36111997-36112019 CATAGGTAGCTGAAATCCAAGGG - Intergenic
950669396 3:14517103-14517125 CATGAGTCCTCGAACTACAATGG - Exonic
961524763 3:127489662-127489684 CCTGGGTTTTTGAACTCCACAGG + Intergenic
962022966 3:131518985-131519007 CATGGTTACTAAAACTGCAAAGG - Intergenic
962872870 3:139513396-139513418 CATGGCAAATTGAACCCCAAGGG - Intergenic
966347343 3:178993950-178993972 CATCGGTCCATGAAATCCAAAGG + Intergenic
969058561 4:4416992-4417014 GATGGGCACTTGGGCTCCAAGGG - Intronic
970630689 4:17940759-17940781 CATGGGTCCATGAACTTGAATGG - Intronic
975162278 4:71137685-71137707 CTTGGAAACTTGAGCTCCAAGGG + Intergenic
978479121 4:109168597-109168619 AATGGGAACTGGAACTCCATCGG - Intronic
980991217 4:139740248-139740270 CTCGAGTTCTTGAACTCCAAAGG - Exonic
982867804 4:160540121-160540143 CATTTGTACCTGAATTCCAAAGG - Intergenic
985520641 5:372627-372649 CAGGGGTGCGTGATCTCCAATGG + Intronic
986696306 5:10358618-10358640 CATGGGTTTTTGAACTACATGGG + Intronic
987582826 5:19818978-19819000 TTTGGATACTTGAACTCTAATGG + Intronic
990851809 5:60213422-60213444 TATACGTTCTTGAACTCCAAAGG + Intronic
994558108 5:101330730-101330752 CATGGGCACTTGAGCTGCCATGG + Intergenic
994864641 5:105251359-105251381 CATGTGTACTTGAGGGCCAAGGG + Intergenic
999361301 5:150988768-150988790 CATTGGTACATGAATTCAAATGG + Intergenic
1001893950 5:175362789-175362811 CATCGGTACTTAAACTCCACAGG - Intergenic
1009355548 6:62740083-62740105 CATGGGTACTTGAGCTGGTAGGG + Intergenic
1009531863 6:64828627-64828649 CATGGATACTTGATGTCCCATGG - Intronic
1017340825 6:153319969-153319991 CATGGGTATTTGACATCCCATGG - Intergenic
1017452879 6:154570762-154570784 CATGGGTCCTTTACATCCAAAGG - Intergenic
1017705961 6:157123086-157123108 CATGGGTGCTTGAGATCCCATGG + Intronic
1023731203 7:43194100-43194122 CAGTGGTGCCTGAACTCCAAAGG + Intronic
1027751031 7:82147202-82147224 CATTGGCTCTTGAACTTCAAAGG + Intronic
1029623754 7:101706896-101706918 CATGGGGACTTGAGCCCCCAAGG - Intergenic
1029884427 7:103851808-103851830 AATGCCTACTTGAACTGCAAAGG - Intronic
1030537775 7:110790491-110790513 CATGGTGGCTTGAACTGCAATGG + Intronic
1030597555 7:111558297-111558319 CATGGGTAGTTCCCCTCCAATGG + Intronic
1036195627 8:6711432-6711454 CATTGGTACTGAAACTCAAATGG + Intronic
1044316084 8:90751306-90751328 CATAGGTAGTGGAAGTCCAAAGG + Intronic
1046470644 8:114669432-114669454 CATTGGTGCCTGAATTCCAAAGG - Intergenic
1048480117 8:134782044-134782066 GATTGGTACTCCAACTCCAATGG + Intergenic
1050820714 9:9876146-9876168 TATGGGTACCTGAGTTCCAATGG + Intronic
1053035720 9:34825610-34825632 CATGAGTCCTTGAACACCCAAGG + Intergenic
1055230447 9:74057827-74057849 AAATGATACTTGAACTCCAATGG - Intergenic
1061398009 9:130353955-130353977 CTTGGGTACTGGAACCTCAAAGG + Intronic
1062460340 9:136660216-136660238 CATGGGTTCTTGGACGCCAGAGG - Intronic
1185910744 X:3978699-3978721 CATGGGTATTTTATCTCTAAAGG + Intergenic
1188380925 X:29490797-29490819 ACTGTGTACTTGAACTTCAAGGG - Intronic
1193469244 X:81878911-81878933 CATGGGCACTCCAAGTCCAATGG + Intergenic
1194375449 X:93127047-93127069 CATGGGGACTTGAATACAAAGGG - Intergenic
1194399421 X:93424443-93424465 CATTGGTACTTAAGCTTCAAGGG + Intergenic
1194956162 X:100183237-100183259 AACGGGTACTTGAACTAGAATGG - Intergenic
1197518742 X:127471815-127471837 CATGGCTAGTCAAACTCCAAGGG - Intergenic
1198456820 X:136825216-136825238 CACGGTTACTTGATATCCAAAGG - Intergenic
1201377084 Y:13334254-13334276 CGTGGGTACCTGAAGTTCAATGG - Intronic