ID: 929264022

View in Genome Browser
Species Human (GRCh38)
Location 2:39898650-39898672
Sequence ATCAACCAGCTATAAATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929264018_929264022 12 Left 929264018 2:39898615-39898637 CCCGGTTGCAAGTTCAGGTGTCA No data
Right 929264022 2:39898650-39898672 ATCAACCAGCTATAAATGGGAGG No data
929264019_929264022 11 Left 929264019 2:39898616-39898638 CCGGTTGCAAGTTCAGGTGTCAC No data
Right 929264022 2:39898650-39898672 ATCAACCAGCTATAAATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929264022 Original CRISPR ATCAACCAGCTATAAATGGG AGG Intergenic
No off target data available for this crispr