ID: 929266969

View in Genome Browser
Species Human (GRCh38)
Location 2:39929135-39929157
Sequence CTGTGCTTCTGGGGAAAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 291}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929266969_929266983 27 Left 929266969 2:39929135-39929157 CCCGCTTTTCCCCAGAAGCACAG 0: 1
1: 0
2: 1
3: 34
4: 291
Right 929266983 2:39929185-39929207 AACCCTGAAAGCCGGGCACCAGG 0: 1
1: 0
2: 0
3: 10
4: 106
929266969_929266977 -1 Left 929266969 2:39929135-39929157 CCCGCTTTTCCCCAGAAGCACAG 0: 1
1: 0
2: 1
3: 34
4: 291
Right 929266977 2:39929157-39929179 GAAGGAAGGAGCCCAGGTGATGG 0: 1
1: 0
2: 10
3: 61
4: 643
929266969_929266980 19 Left 929266969 2:39929135-39929157 CCCGCTTTTCCCCAGAAGCACAG 0: 1
1: 0
2: 1
3: 34
4: 291
Right 929266980 2:39929177-39929199 TGGCCGTCAACCCTGAAAGCCGG 0: 1
1: 0
2: 0
3: 0
4: 52
929266969_929266976 -7 Left 929266969 2:39929135-39929157 CCCGCTTTTCCCCAGAAGCACAG 0: 1
1: 0
2: 1
3: 34
4: 291
Right 929266976 2:39929151-39929173 AGCACAGAAGGAAGGAGCCCAGG 0: 1
1: 0
2: 8
3: 42
4: 550
929266969_929266981 20 Left 929266969 2:39929135-39929157 CCCGCTTTTCCCCAGAAGCACAG 0: 1
1: 0
2: 1
3: 34
4: 291
Right 929266981 2:39929178-39929200 GGCCGTCAACCCTGAAAGCCGGG 0: 1
1: 0
2: 0
3: 8
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929266969 Original CRISPR CTGTGCTTCTGGGGAAAAGC GGG (reversed) Intergenic
900331550 1:2137276-2137298 CAGTGCGGCTGGGGCAAAGCAGG - Intronic
900429686 1:2595774-2595796 CTGTGGAGCTGAGGAAAAGCAGG - Intronic
900526265 1:3130274-3130296 GTGGGGTTCTGGGGAGAAGCTGG + Intronic
900637457 1:3672910-3672932 CGGTGCTCCTGGGGGTAAGCGGG - Intronic
900726381 1:4218983-4219005 CTGTGTTCCTGGGGAAGAGGTGG + Intergenic
900739208 1:4320437-4320459 CTGTGCTCCTAGAGAAAAGTTGG + Intergenic
901665544 1:10824197-10824219 CTGAGCTGCTGGGGAAAGGGTGG + Intergenic
904043147 1:27595591-27595613 CTGTGGTTTTGGGGAGGAGCTGG + Intronic
904259553 1:29280468-29280490 CTGTGCTTCCAGGAAAAGGCTGG - Intronic
904833722 1:33321425-33321447 CTTTGGTTCTTGGGAACAGCTGG + Intergenic
906534698 1:46544959-46544981 CTTTGCATCTGGGGAAAGCCAGG + Intergenic
907897293 1:58703734-58703756 CTGTACTTCTGAGGAAAACGTGG + Intergenic
907900170 1:58733924-58733946 CTGAGCTGCTGTGTAAAAGCGGG - Intergenic
908720315 1:67118573-67118595 TTGAGTTTCTGGGGAAATGCTGG + Intronic
908788837 1:67761111-67761133 CTAGGATTCTGGGGTAAAGCTGG + Intronic
909299652 1:73996131-73996153 CTCTGCTTCTGGTGAAAAAAAGG + Intergenic
910090733 1:83460694-83460716 CTATGTTTCTGGGGAACACCAGG - Intergenic
910670363 1:89766609-89766631 GTGTGCTTGTGGGCAAATGCAGG - Intronic
912371313 1:109176338-109176360 GAGTGTTTCTGGGGAAAAGATGG - Intronic
915280467 1:154818912-154818934 GTGAGCTTCTGGGGCAAGGCTGG + Intronic
915457524 1:156050819-156050841 CTGTGAGTCTGGGGAAAAGTTGG - Intronic
917256401 1:173120966-173120988 GTCTGCTTCTGGGGGCAAGCAGG - Intergenic
917505047 1:175619785-175619807 TTTTTCCTCTGGGGAAAAGCAGG - Intronic
917535179 1:175869321-175869343 CTGAACTTCTGGGGAGAAGCAGG - Intergenic
917608819 1:176665390-176665412 CTATTTCTCTGGGGAAAAGCTGG + Intronic
919775894 1:201193871-201193893 GTGTGTCACTGGGGAAAAGCTGG - Intronic
919914833 1:202132907-202132929 CTGTGCTTCAGGGGTAGGGCTGG - Exonic
922738963 1:228005196-228005218 TTGTGGTACTGGGGAAAACCTGG - Intergenic
922791612 1:228314220-228314242 CTGCCCTTCTGGGAAAGAGCTGG + Intronic
922969976 1:229728017-229728039 CTGTCCTTGTGGGGCAAGGCAGG - Intergenic
923958960 1:239055619-239055641 CTATGCTTGTGGGGAGAAACAGG - Intergenic
924085920 1:240451501-240451523 CAGTGGTTCTGGGGATGAGCTGG + Intronic
924448265 1:244154847-244154869 CTGTGCTCCTGTAGAAACGCTGG + Intergenic
1065796485 10:29312792-29312814 CTGTTCTGCTGGGGCAGAGCTGG + Intronic
1067829998 10:49606130-49606152 CTGTATTTCTGTGGAGAAGCAGG - Intergenic
1067937778 10:50625205-50625227 TTCCGCCTCTGGGGAAAAGCGGG - Intergenic
1069351648 10:67533573-67533595 GTGTTCTTTTGGGGAAAAACAGG - Intronic
1070719466 10:78746275-78746297 CTCTCCTGCTGGGGGAAAGCTGG - Intergenic
1070961840 10:80505077-80505099 CTGTGCCTCTGGGAGCAAGCGGG + Intronic
1071581048 10:86770502-86770524 CTTTTCTTCTGGGGACAAGTGGG - Intronic
1073069593 10:100784791-100784813 CTGTGACTCTGGGGAAAAACTGG + Intronic
1073080781 10:100859344-100859366 CTCTCCTTCTGGGGAGAAGCTGG + Intergenic
1077266450 11:1653165-1653187 GTGTGCTTCAGGGGACAAGGAGG - Intergenic
1077573294 11:3357032-3357054 CGGTGCTGTTGGGGAAAAGTTGG + Intronic
1077575585 11:3380554-3380576 CTCTGCTTCTGGGGATGAGATGG + Intergenic
1077743355 11:4872611-4872633 CTGAGCTGCTGAGTAAAAGCTGG - Intronic
1078900386 11:15636785-15636807 CTCTGTTTCTGGGGATTAGCTGG + Intergenic
1080618354 11:33965707-33965729 CTCTCCTTCTGGGGAGAAGGAGG + Intergenic
1082735375 11:56849410-56849432 ATGAGCTTCTGGGTTAAAGCAGG + Intergenic
1083055010 11:59810949-59810971 CTCTTCTTCTGGGGAAAGACTGG - Intergenic
1084068848 11:66720874-66720896 CTATGCTTGGGGGGAAGAGCTGG + Intronic
1084686594 11:70699728-70699750 ATGTGCTTTTGGTGAACAGCTGG - Intronic
1084991055 11:72925968-72925990 CTGTGCTCCTGGGGGAGGGCCGG + Intronic
1086062997 11:82719526-82719548 CTGTGAGTCTGGGGAAGAACTGG + Intergenic
1088181443 11:107117199-107117221 CAGTGCTTCTGAAGAAAGGCAGG + Intergenic
1088738582 11:112748671-112748693 CTGAGCTTCTGAGGCAAAGTTGG + Intergenic
1090400022 11:126443129-126443151 TGGCGTTTCTGGGGAAAAGCAGG - Intronic
1091621824 12:2094764-2094786 CTGTGCTTCAGGGGAAATGTTGG + Intronic
1092273492 12:7041463-7041485 CTGTCCTCATGGGGAAAGGCAGG + Intronic
1092380666 12:7994247-7994269 GTGCCCTTCTGGGAAAAAGCAGG - Intergenic
1092525077 12:9304930-9304952 GTGTAATTCAGGGGAAAAGCTGG - Intergenic
1092542190 12:9426888-9426910 GTGTAATTCAGGGGAAAAGCTGG + Intergenic
1093147919 12:15588845-15588867 CTCTGCTTCTGCAGAAAAGTAGG - Intronic
1094280482 12:28732115-28732137 CTGTTCCTCTGGGGAAAAGAAGG + Intergenic
1094510823 12:31095545-31095567 GTGTAATTCAGGGGAAAAGCTGG - Intronic
1095328704 12:40930734-40930756 CTGTGCTTAGGGGTAAAGGCAGG - Intronic
1096354003 12:50924796-50924818 CTTTCCTTCTGAGGAAAAGCTGG + Exonic
1098068833 12:66649866-66649888 CTTTCCTTCTGTGGAAGAGCAGG + Intronic
1098837164 12:75437759-75437781 TGGTGCTTATGGGTAAAAGCTGG + Intergenic
1100790349 12:98123455-98123477 CTGTGCTTCTCTAGGAAAGCAGG - Intergenic
1101007953 12:100419889-100419911 CTTTGCTTCTGGGGAGAAACAGG + Exonic
1101812910 12:108123068-108123090 CAGTGCTTCTGGGGGAAGGAAGG + Intergenic
1102402664 12:112643636-112643658 GTGTGCTTCTGGGGAAACCCAGG - Intronic
1102732918 12:115129866-115129888 CTGTGCTGCAGGTAAAAAGCTGG + Intergenic
1103328490 12:120137569-120137591 CTGTGGTTCTGGAGGAGAGCTGG - Exonic
1103413760 12:120730694-120730716 CTGTGTTTCTGGGGATGAGATGG + Intronic
1105880971 13:24606581-24606603 CTGTGCTGCTGGGCCCAAGCTGG + Intergenic
1106963652 13:35033043-35033065 CTGTGCTTGTGGGGTATTGCTGG + Intronic
1107484637 13:40813898-40813920 CTGTGCTGCTGGGCCCAAGCTGG - Intergenic
1111405014 13:87792953-87792975 ATGTTTTTCTGTGGAAAAGCTGG - Intergenic
1111696457 13:91630774-91630796 CTTTTCTTCTGGGGAAAATGTGG + Intronic
1112371961 13:98802095-98802117 CTGTGCTTCAGGGGAAGAGTGGG + Intronic
1115427144 14:33273180-33273202 CAGTGAGTCTGGGGAAGAGCGGG - Intronic
1115941858 14:38618690-38618712 TGGTGCTTATGGGTAAAAGCTGG - Intergenic
1116309701 14:43308545-43308567 GACTGCTTCTGGGAAAAAGCAGG - Intergenic
1117667878 14:58076328-58076350 CCATGATTCTTGGGAAAAGCAGG - Intronic
1118471215 14:66076978-66077000 CTGAGCTTCTGGGGAGAAATGGG + Intergenic
1118795797 14:69142468-69142490 CTCTGCTTCTGTGGAAAAGAAGG - Intronic
1119616290 14:76101112-76101134 CAGTGATTCTGGGGAATAGTGGG - Intergenic
1119912898 14:78367165-78367187 CTGTGCTTCTGGGCAATTGGTGG + Intronic
1120697512 14:87660150-87660172 CTGTTCTTCTGTGGCTAAGCTGG - Intergenic
1120945590 14:89993165-89993187 CAGTGCTTCTTGTGAAAAGTGGG + Intronic
1121020275 14:90575634-90575656 CTGGGCTCCTGGGGACAGGCTGG + Intronic
1122149703 14:99718281-99718303 GTGTTCTCCAGGGGAAAAGCAGG - Intronic
1122241736 14:100372977-100372999 CTATGCTTCTGGGAACAAGTTGG + Intronic
1202848525 14_GL000225v1_random:1371-1393 CTCTGCAGCTGGGCAAAAGCTGG + Intergenic
1125375153 15:39020969-39020991 CTCTACTTCTGGGGAGGAGCTGG - Intergenic
1127354302 15:58183319-58183341 CTATAGTTCTGGGGAAAAGCAGG - Intronic
1128525705 15:68410889-68410911 CTCTGACTCTGGGGAGAAGCAGG + Intronic
1128942913 15:71802920-71802942 CGGTGCTACTGGGGAACTGCCGG - Intronic
1129002599 15:72346807-72346829 CTTTGCTGCTGGGGAACAGAGGG - Intronic
1129761602 15:78131845-78131867 CTGTCCCTCTGGGGAGAAGGAGG + Intronic
1130231419 15:82100112-82100134 CTGTGCTTCCAGGGAAAGCCTGG - Intergenic
1131409796 15:92197975-92197997 CTGTGCTTCAGGGCAGAAACAGG + Intergenic
1132556554 16:575241-575263 CTGTGATTGTGGAGAGAAGCAGG - Intronic
1132757922 16:1494911-1494933 CTGTGCTTCCCTGGAAAACCTGG - Intronic
1133222033 16:4322962-4322984 CTTGGCTTCTGGGGGAGAGCAGG - Intronic
1133676661 16:8079726-8079748 CTGGGGTTCTGGGGAACACCTGG + Intergenic
1133767279 16:8846824-8846846 CTGAGCTGCTGGCTAAAAGCAGG - Intronic
1134507894 16:14822998-14823020 CTGTGCTTCCTGAGAACAGCAGG - Intronic
1134695595 16:16221761-16221783 CTGTGCTTCCTGAGAACAGCAGG - Exonic
1134821630 16:17251817-17251839 CAGGGCTTCTGGGGAAGAGGTGG + Intronic
1134976234 16:18572925-18572947 CTGTGCTTCCTGAGAACAGCAGG + Intergenic
1136284445 16:29232934-29232956 CTGTGCTCCTGGGGATAGGTGGG - Intergenic
1137369917 16:47895798-47895820 CTCTGCTTCTGGGGAAAAACTGG - Intergenic
1137427776 16:48394309-48394331 CTGTGCCTCTGGGGCACAGCTGG - Intronic
1137822821 16:51462056-51462078 CTGAGGTTCTGGGGACTAGCAGG - Intergenic
1138916505 16:61471351-61471373 CTGTGCTGCTGTGGCTAAGCTGG - Intergenic
1139728556 16:68922791-68922813 CAGAGCTTCTGGTTAAAAGCTGG + Intronic
1139884212 16:70197199-70197221 CTCTGCTTCTTGGGAACAGGAGG + Intergenic
1140368303 16:74398297-74398319 CTCTGCTTCTTGGGAACAGGAGG - Intergenic
1141467637 16:84217087-84217109 ATATGCTGCTGGGGAAAGGCAGG + Intergenic
1142089480 16:88202447-88202469 CTGTGCTCCTGGGGACAGGTGGG - Intergenic
1143314601 17:6022759-6022781 CTGTGGTTCATGAGAAAAGCTGG + Intronic
1144463950 17:15481568-15481590 CTGTGGTTCTAGGGAAGACCTGG - Intronic
1144557394 17:16294358-16294380 CTGAGCTTCTGGGGTGAAACTGG + Intronic
1145035573 17:19538218-19538240 TCCTGCTTCTGGGGAAAAGAAGG - Intronic
1148373568 17:47121374-47121396 CTGTGTTTCTGTGGACTAGCAGG - Intronic
1148612361 17:48972789-48972811 ATGTGACTGTGGGGAAAAGCTGG - Intergenic
1149414121 17:56440700-56440722 CTAATCTTCTGGGGGAAAGCAGG + Intronic
1151074492 17:71255538-71255560 CTGACATTCTGGGGAAATGCTGG - Intergenic
1151426274 17:74032868-74032890 CTATGCTTTTGAAGAAAAGCTGG + Intergenic
1151631763 17:75315826-75315848 CAGTGTGTCAGGGGAAAAGCTGG - Intergenic
1151728515 17:75897769-75897791 CTCAGCTTCAGGGGAAATGCTGG - Intergenic
1151734585 17:75931179-75931201 CAGTGTTTCTGGGGATAAGTAGG + Intronic
1152326894 17:79646865-79646887 GTGGGTATCTGGGGAAAAGCAGG - Intergenic
1152458805 17:80430806-80430828 CTGTGCCTCTGGGGCAAGGCAGG - Intronic
1152588302 17:81198901-81198923 CTGTGGTTCTGGGGATGAGTCGG + Exonic
1152644013 17:81460626-81460648 CTGTGCTTTGGGGGACAGGCTGG - Exonic
1153831040 18:8922925-8922947 TTGTGCTTCTTGTGAATAGCTGG - Intergenic
1155251705 18:23959268-23959290 CTGCACTTCTGGGGAAAACATGG - Intergenic
1155289473 18:24326206-24326228 CTGTGCTTCTGGGGACAATGTGG + Intronic
1156211722 18:34951722-34951744 CTGTGCACCTGGGAACAAGCAGG - Intergenic
1158021548 18:52848032-52848054 CTGTACTTCAGAGGAAAAACAGG + Intronic
1159941680 18:74413271-74413293 CAGGGCTACAGGGGAAAAGCAGG - Intergenic
1160134761 18:76262733-76262755 CTCTGCTTCTCAGGAAGAGCTGG + Intergenic
1160218161 18:76952474-76952496 CTGTGCTTCTGGGAGGAAGCTGG + Intronic
1160513782 18:79467287-79467309 CTGTGCTGCCGTGGAAACGCGGG + Intronic
1160718844 19:588988-589010 CTCTGCTTCTGGGCCGAAGCCGG - Intergenic
1161720281 19:5898442-5898464 CTGTGCTTGTGGGGAGCAGATGG - Intronic
1162372133 19:10285983-10286005 CACTCCTTCTGGGGAAAGGCAGG - Exonic
1163458921 19:17424784-17424806 GTGTGTGTCTGGGGCAAAGCGGG - Intronic
1165078446 19:33293864-33293886 CTGTGTTTCTGGTGAAAGGTTGG + Intergenic
1166279141 19:41778933-41778955 TTGTTCATCTGGGGAAAAGATGG + Intergenic
1166303472 19:41924828-41924850 CGGTGTTTCTGGAGAGAAGCAGG + Intronic
1166485283 19:43206750-43206772 GTGTGCTTGTGGGGAGAAGGGGG - Intronic
1168137023 19:54359055-54359077 CTGGGCTGCTGGGGCACAGCGGG - Intronic
1168161058 19:54510074-54510096 CTGGGCTGCTGGGGCACAGCGGG + Intronic
925680293 2:6413422-6413444 CTTTGTAGCTGGGGAAAAGCTGG - Intergenic
925719205 2:6811687-6811709 CTGTGCTGTTGGGGACCAGCTGG + Intergenic
925828251 2:7871765-7871787 TACTGGTTCTGGGGAAAAGCGGG + Intergenic
926716587 2:15928932-15928954 CTGTGCTTCTGGAGGAACCCCGG + Intergenic
927569502 2:24145513-24145535 CTGTGCATCTGGGGTAATGGAGG - Intronic
928294869 2:30073844-30073866 CTGTACTTCTGGCAAAAAGGTGG + Intergenic
929266969 2:39929135-39929157 CTGTGCTTCTGGGGAAAAGCGGG - Intergenic
929310495 2:40418856-40418878 GTTTTCTTCTGGGGAAAAGCAGG + Intronic
929331450 2:40686321-40686343 CTCTGCTTCTGGGGGTTAGCTGG + Intergenic
929631981 2:43472556-43472578 CTAGGTTTCTGGGGAAAACCGGG + Intronic
930643416 2:53877959-53877981 CTGTTCTACTGGGAAAAATCGGG + Intronic
931902164 2:66802104-66802126 CTCTGCTACTTTGGAAAAGCAGG - Intergenic
932327118 2:70870708-70870730 CTGTGCTTCTGGAGAAGAGTTGG + Intergenic
934153244 2:89170543-89170565 CTGTGCTGCTGGGGCTAAGCAGG + Intergenic
934213991 2:90011388-90011410 CTGTGCTGCTGGGGCTAAGCAGG - Intergenic
934791072 2:97060599-97060621 CTTTGCTTCTGGGGATGAGGAGG - Intergenic
934815375 2:97321931-97321953 CTTTGCTTCTGGGGATGAGGAGG + Intergenic
934822320 2:97386552-97386574 CTTTGCTTCTGGGGATGAGGAGG - Intergenic
935685574 2:105679751-105679773 GTATGCTTCTGGGGAAACTCAGG + Intergenic
936037334 2:109123390-109123412 CTGTGCTTCAGGGGAAGGGAGGG - Intergenic
937265460 2:120612279-120612301 CTTCCCTCCTGGGGAAAAGCGGG - Intergenic
941274605 2:163475141-163475163 CTGCAGTTCTGGGGCAAAGCTGG - Intergenic
941925492 2:170890106-170890128 CTGTGTTTCAAGGGACAAGCTGG - Intergenic
942326076 2:174778239-174778261 GTGGGATTCTGGAGAAAAGCCGG - Intergenic
943788484 2:191905380-191905402 CAGTGCTTCTGGAGAAAACAAGG + Intergenic
946450263 2:219773620-219773642 CAGTGCTTCTGGGCACAAGATGG - Intergenic
947040253 2:225910419-225910441 CTGTATCTCTGGGGAGAAGCAGG - Intergenic
947444964 2:230156509-230156531 CTGTGCTTCGTGGGGAAGGCGGG - Intergenic
948739404 2:240033142-240033164 CTGTGCCTCTGGGGCCAGGCTGG + Intergenic
1169488589 20:6053285-6053307 CAGTTCTAATGGGGAAAAGCGGG - Intronic
1170710876 20:18789633-18789655 CTGTCCTTATGGGAAGAAGCAGG - Intergenic
1171265393 20:23767667-23767689 CTGAGCTCCTGGGGAAGAGAAGG - Intergenic
1171277616 20:23871448-23871470 GTGAGCTCCTGGGGAAAAGAGGG - Intergenic
1171415142 20:24973295-24973317 CAGTGCTGCTGTGGAAAAGTAGG - Intronic
1172039175 20:32031578-32031600 CTGGACTTCTGGGACAAAGCAGG - Exonic
1173732343 20:45337702-45337724 CTGGGCTTCTGGGGAGAGGCAGG + Intronic
1174771150 20:53301729-53301751 CTGTGCTTTTAGGGATGAGCGGG - Intronic
1175365637 20:58453547-58453569 CTGAGCTTCTGGGAAACAGGAGG - Intergenic
1176205217 20:63884551-63884573 CTGTGCTTCCAGAGAAAAACAGG - Intronic
1178807154 21:35848833-35848855 CTGTGCTTCTGGGGACTTGGAGG - Intronic
1179133016 21:38655820-38655842 CTGTGCTTCTGTTGAAAAGTGGG - Intronic
1179187303 21:39094767-39094789 CTCTCATTCTGGGGACAAGCTGG - Intergenic
1179603646 21:42497515-42497537 CTTTTCTTATGGGGAAAAGTGGG + Intronic
1180216291 21:46325242-46325264 CTGGGGTGCTGGGGAAGAGCGGG + Intronic
1180902548 22:19385301-19385323 CTGGGCTCCTGGGGATAAGGAGG + Intronic
1181853401 22:25765935-25765957 CTGACCTTCTGGGGGAAGGCAGG - Intronic
1182083565 22:27545758-27545780 TTGTGGTGCTGGGGAAAAACAGG - Intergenic
1182586607 22:31347111-31347133 CTGTGGTTTGGGGGAGAAGCTGG - Intergenic
1183342453 22:37289112-37289134 CTGGTCTTCTGGAGAAAAGATGG + Intronic
952192270 3:31036200-31036222 CTCTGATTCTGGGGAAAAATTGG + Intergenic
952819933 3:37477528-37477550 ATTTGTTTCTGGGGAAAACCTGG - Intronic
952905039 3:38134249-38134271 CTGTGCTGATTTGGAAAAGCTGG - Intronic
953232171 3:41074916-41074938 GTGTGATTCTGGGGACAAGAAGG - Intergenic
953877644 3:46675513-46675535 AGGTGCTTCTGGGGAAGTGCTGG - Intronic
954622931 3:52005989-52006011 CAGTGCTTCTTGAGAAAACCTGG + Intergenic
956600623 3:71018036-71018058 CTGTGCTTCCTGGGTTAAGCTGG + Intronic
956833166 3:73073276-73073298 CTGTGCATCTGTAGAAAAGGGGG + Intergenic
957849024 3:85781008-85781030 CTTGGCTTCTGGGGATAGGCTGG - Intronic
957873320 3:86114367-86114389 TTGTTCAACTGGGGAAAAGCAGG - Intergenic
960190814 3:114703349-114703371 TTGTGGTACTGGGAAAAAGCAGG + Intronic
962076897 3:132091423-132091445 TTGTCCTGATGGGGAAAAGCAGG - Intronic
963296562 3:143553016-143553038 CTGTGCCTCTTTGGAAAGGCTGG + Intronic
966990944 3:185229465-185229487 CAGTGAGTCTGGGGAGAAGCTGG + Exonic
967814593 3:193788241-193788263 CTGTGTTGCTGGGGAGAAGGTGG + Intergenic
967877760 3:194278457-194278479 CTGTGCTGCTGGGGCCAAGAGGG - Intergenic
968043919 3:195612790-195612812 CTGTGCTGCTGGGAAGAAGGAGG - Intergenic
969444913 4:7239262-7239284 CTGAGCTTCTGCAGAAAGGCTGG + Intronic
969706669 4:8796120-8796142 CTGAGCTTCTGGGCAGAACCAGG - Intergenic
971562733 4:28101802-28101824 CTGTGCTTCTGGGAAGATGGTGG + Intergenic
975221278 4:71814910-71814932 CTGAGCTTGTGGGGAAAAACAGG + Intergenic
975780630 4:77835895-77835917 ATTTTCTTCTGGGGAAAATCTGG - Intergenic
976453661 4:85220409-85220431 CTGGGCTTCTGGGGAGCTGCAGG - Intergenic
978372882 4:108046842-108046864 CGGTGCAGCTGGGGAACAGCTGG - Intergenic
978852831 4:113358439-113358461 CTGTTCTTCTGGGGAAGAATCGG - Exonic
983189505 4:164740113-164740135 CTGTGGCTCTAGGGAGAAGCTGG - Intergenic
983318139 4:166158613-166158635 CTGTGCTAGTGGGTAAATGCAGG + Intergenic
984303918 4:177962523-177962545 CTGAGCTGCAGGGGAAAACCTGG + Intronic
984349543 4:178572150-178572172 GTATGTTTATGGGGAAAAGCGGG - Intergenic
985795653 5:1960100-1960122 CCCTGCTCCTGGGGAAACGCAGG - Intergenic
989418825 5:41211463-41211485 CTGTGTTGCTGAGGAAAACCAGG - Intronic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
991905975 5:71510986-71511008 CTGTGTTACTGAGGAAAAGGTGG + Exonic
992445628 5:76830995-76831017 CTCTAATTCTGGGGAAAAGTAGG - Intronic
992624375 5:78623976-78623998 TTGTTATTCTGGGGAAAACCAGG - Intronic
993316676 5:86416243-86416265 CTTTGCTTGTGGGGCAAAGAAGG - Intergenic
997709707 5:135993649-135993671 CTGTGCTTCTGAGATAAAGTAGG - Intergenic
1000373233 5:160556895-160556917 CTTTGCTTATGGGGAAAAGAAGG + Intergenic
1000621509 5:163492022-163492044 TTGTGATTCTGGGGACAAGGTGG - Intergenic
1002453495 5:179332607-179332629 CTGGGCTTCTGGGGCAATGCAGG - Intronic
1003316219 6:5014418-5014440 CTCTGCTTCTGGGGGTGAGCTGG + Intergenic
1003570562 6:7253815-7253837 CTGTGTTGCTGGGGACAAGCTGG + Intergenic
1004335722 6:14762697-14762719 CTGTGTCTGTGGGGAAAATCAGG - Intergenic
1005153303 6:22776969-22776991 CTCTGCAACTGAGGAAAAGCTGG - Intergenic
1006576539 6:35050678-35050700 CTGTGCAGATGGGGAGAAGCCGG - Intronic
1007048658 6:38803403-38803425 CTTTGCTTCTGGGGAAGGGAGGG - Intronic
1007220020 6:40271078-40271100 CTATTCATCTGGGGAAAAGATGG - Intergenic
1007255668 6:40526619-40526641 CTGAGCTCTTGGGGAAGAGCTGG - Intronic
1007321567 6:41032035-41032057 TTCTGCTTCCGGAGAAAAGCAGG - Exonic
1007487212 6:42189322-42189344 ATATGCTCCTGGGGAAAAGAGGG + Intronic
1008206425 6:48664687-48664709 CTGTGGGGGTGGGGAAAAGCTGG + Intergenic
1011215821 6:85004576-85004598 CTGGGCTGCTGGGGAAGACCAGG - Intergenic
1014216334 6:118755849-118755871 CTCTGCATCAGGGGAAATGCAGG - Intergenic
1015913408 6:138190709-138190731 CTGTGTTTCCTGGGAAAAGTGGG + Intronic
1019618164 7:1976133-1976155 GTGTGCATCTGGGCAAGAGCAGG + Intronic
1019951559 7:4377252-4377274 CAGTCCTTCTGGGGAAAGCCAGG - Intergenic
1020052142 7:5088679-5088701 CTGTTCTTCTGGAGAGAGGCGGG - Intergenic
1020713187 7:11635106-11635128 CTGCGCTTCTGGTGAACAGCTGG - Intronic
1020974316 7:14986370-14986392 CTGTGCTGCTGGAGAAAGGTGGG + Intergenic
1023245415 7:38198125-38198147 CTGTGAATCTGGGGTAAGGCAGG + Intronic
1023588597 7:41757621-41757643 CTGAGCTCCTTGGGAAAAACAGG - Intergenic
1024185122 7:46941499-46941521 CAGCGTTTCTGGGGAAAACCTGG - Intergenic
1024604314 7:51012015-51012037 GTGTGCTCCTGGGGGAACGCAGG - Intergenic
1024977360 7:55126081-55126103 CTGGGCTTCTAAGGACAAGCGGG - Intronic
1026069234 7:67102998-67103020 CTGTGCTTCAGGGAATAAGCAGG + Intronic
1026707666 7:72709315-72709337 CTGTGCTTCAGGGAGTAAGCAGG - Intronic
1026918552 7:74138373-74138395 CTGTGCTGTGGGGGAAAAGACGG + Intergenic
1027787459 7:82598377-82598399 CTGGGCTTCTGGGGAATCGTGGG - Intergenic
1028654514 7:93188327-93188349 ATGTGCTTCTGTGAAAATGCAGG + Intergenic
1029317484 7:99727593-99727615 CTGTGATTCAGGTGAAAAACAGG - Intronic
1030322384 7:108182656-108182678 CTGTTTTGCTGGGGAAAAGTAGG + Intronic
1030595211 7:111529999-111530021 CTCTGATTCAGTGGAAAAGCAGG + Intronic
1031454951 7:121967936-121967958 CAGTGCTCCTAGGGAAAAGAAGG - Exonic
1034358906 7:150477104-150477126 TTGTCCTTGTGGGGAGAAGCGGG + Exonic
1035016911 7:155774662-155774684 CTGTGCTTGTGGTGATAAGGGGG + Intronic
1035461539 7:159042043-159042065 ATGTGCCTCTGGGGATAAGCTGG - Intronic
1036078343 8:5525332-5525354 ATGTCCTTTTGGGGAGAAGCTGG - Intergenic
1036216621 8:6884804-6884826 CTGTGCCTCTGTGGAGAGGCAGG + Intergenic
1036803868 8:11813912-11813934 CTGGGTTTCTGGGGAAAACGTGG + Intronic
1037323045 8:17661857-17661879 GTGTGCTGCTGGGGAACAGCTGG + Intronic
1037718699 8:21422322-21422344 CAGTGCATCTGGGGATAAGAGGG + Intergenic
1038067607 8:23979415-23979437 AGCTGCTTCTGGGGAAGAGCTGG - Intergenic
1040547275 8:48408511-48408533 CTGTAGTTCTGGGGCAGAGCAGG - Intergenic
1041330433 8:56718485-56718507 ATGTGCTTCAGGGAAAAAGCAGG + Intergenic
1041896844 8:62934822-62934844 TTGTGCTACTGGGGAAAAAACGG + Intronic
1042880620 8:73484697-73484719 CATTTCTTCTAGGGAAAAGCAGG - Intronic
1042930956 8:74013803-74013825 ATGTGCTTGTGGGGAATTGCTGG + Intronic
1044957614 8:97497991-97498013 CTTTGATTCTTGGGAAAGGCTGG + Intergenic
1045079579 8:98610618-98610640 CTGTCCTAATGAGGAAAAGCAGG + Intronic
1045162521 8:99564479-99564501 CTCTGCATCTGGGGTAAGGCCGG + Intronic
1046351822 8:113025319-113025341 CTTTGATTCTGGGTAGAAGCAGG + Intronic
1046524446 8:115366403-115366425 TTGTACTTATGGGCAAAAGCTGG - Intergenic
1047834001 8:128668027-128668049 CTGTTCTTCTCAGGAAAGGCGGG + Intergenic
1048294966 8:133207277-133207299 CTGGACTTCAGGGGAGAAGCAGG + Intronic
1048590214 8:135814358-135814380 CTGTCCCATTGGGGAAAAGCAGG + Intergenic
1049225609 8:141449169-141449191 CTGGGCTTATGAGGAAAACCAGG + Intergenic
1049612683 8:143562723-143562745 CCGGGCTCCTGGGGAACAGCTGG + Exonic
1050087167 9:1978144-1978166 CTGTGGTTCTGTGGCAAAGGTGG - Intergenic
1051788780 9:20775983-20776005 CTTTGCTTCTGTGGAAACCCAGG - Intronic
1051918501 9:22235944-22235966 CTGTCCTCCTGGGGAGATGCAGG + Intergenic
1053366732 9:37528093-37528115 CTGTGCTTTAGGAGAATAGCTGG - Intronic
1053419553 9:37968857-37968879 CTGTCCTTCTGGGGAAACTAAGG - Intronic
1053439056 9:38099714-38099736 CTGTGATAATAGGGAAAAGCAGG - Intergenic
1053469585 9:38336620-38336642 CTGTGCATCTGGGGGATAGCAGG - Intergenic
1056631352 9:88295649-88295671 CTGTGGATCTGGGGAAGAGGGGG - Intergenic
1059715146 9:116906403-116906425 CTGTGCTTTTCGGGAGAAGCAGG + Intronic
1060113189 9:120921039-120921061 ATGGACTTCTGGTGAAAAGCTGG - Intronic
1060532706 9:124357485-124357507 CGGTAGTTCTGGGGAAATGCTGG + Intronic
1061864157 9:133483898-133483920 CTGCCTTTCTGGGGAAGAGCTGG - Intergenic
1186317337 X:8385249-8385271 CTGTGGTTCAGCTGAAAAGCAGG - Intergenic
1189023011 X:37361868-37361890 GTTTGCTTCAGGGAAAAAGCAGG + Intronic
1189803021 X:44709133-44709155 CTCAGCCTCTGGGAAAAAGCTGG - Intergenic
1190076738 X:47322455-47322477 CCCTGCTCCTGGGGACAAGCAGG + Intergenic
1190132976 X:47768362-47768384 CTGGGCTTCCTGGCAAAAGCAGG + Intergenic
1192612115 X:72577039-72577061 CTCCCCTTCTGGGGAAAAGCAGG - Intergenic
1193312482 X:80024557-80024579 CTGGGCATCTGGGGACATGCTGG + Intronic
1195079566 X:101358166-101358188 CTGTGATACTGGGTAGAAGCTGG - Intronic
1195698838 X:107686601-107686623 CTGGGCATCCGGGGAGAAGCAGG + Intergenic
1199079354 X:143558946-143558968 CTGTCCTTTAGGGGAAAAGGGGG + Intergenic
1199652394 X:149959403-149959425 CCGTGATTCTGGGTAAGAGCAGG + Intergenic