ID: 929269111

View in Genome Browser
Species Human (GRCh38)
Location 2:39953457-39953479
Sequence CAGGGAAAACAGTAAGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929269105_929269111 12 Left 929269105 2:39953422-39953444 CCAGTCTCATTATTACAATTTGG No data
Right 929269111 2:39953457-39953479 CAGGGAAAACAGTAAGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929269111 Original CRISPR CAGGGAAAACAGTAAGAGAA AGG Intergenic
No off target data available for this crispr