ID: 929269140

View in Genome Browser
Species Human (GRCh38)
Location 2:39953772-39953794
Sequence GCATATACTAGGTTTATAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929269132_929269140 24 Left 929269132 2:39953725-39953747 CCCTTTTTTGAGCTGTCCCGAGA No data
Right 929269140 2:39953772-39953794 GCATATACTAGGTTTATAAAAGG No data
929269133_929269140 23 Left 929269133 2:39953726-39953748 CCTTTTTTGAGCTGTCCCGAGAA No data
Right 929269140 2:39953772-39953794 GCATATACTAGGTTTATAAAAGG No data
929269136_929269140 8 Left 929269136 2:39953741-39953763 CCCGAGAATTGGATAAGGAACTG No data
Right 929269140 2:39953772-39953794 GCATATACTAGGTTTATAAAAGG No data
929269137_929269140 7 Left 929269137 2:39953742-39953764 CCGAGAATTGGATAAGGAACTGT No data
Right 929269140 2:39953772-39953794 GCATATACTAGGTTTATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929269140 Original CRISPR GCATATACTAGGTTTATAAA AGG Intergenic
No off target data available for this crispr