ID: 929269216

View in Genome Browser
Species Human (GRCh38)
Location 2:39954780-39954802
Sequence GTCCAGGTTGCACTGTGTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929269214_929269216 -6 Left 929269214 2:39954763-39954785 CCAATTCAGAGGTGCAAGTCCAG No data
Right 929269216 2:39954780-39954802 GTCCAGGTTGCACTGTGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929269216 Original CRISPR GTCCAGGTTGCACTGTGTTA TGG Intergenic