ID: 929269365

View in Genome Browser
Species Human (GRCh38)
Location 2:39956737-39956759
Sequence AGGTAGGCTCAGAATTGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929269357_929269365 15 Left 929269357 2:39956699-39956721 CCTTTGGTCTCCATCTGACCAAG No data
Right 929269365 2:39956737-39956759 AGGTAGGCTCAGAATTGTGGAGG No data
929269360_929269365 5 Left 929269360 2:39956709-39956731 CCATCTGACCAAGTAAGGGTAGA No data
Right 929269365 2:39956737-39956759 AGGTAGGCTCAGAATTGTGGAGG No data
929269361_929269365 -3 Left 929269361 2:39956717-39956739 CCAAGTAAGGGTAGAATTCAAGG No data
Right 929269365 2:39956737-39956759 AGGTAGGCTCAGAATTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929269365 Original CRISPR AGGTAGGCTCAGAATTGTGG AGG Intergenic
No off target data available for this crispr