ID: 929269825

View in Genome Browser
Species Human (GRCh38)
Location 2:39960774-39960796
Sequence AACAGCTCTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929269825_929269829 13 Left 929269825 2:39960774-39960796 CCAGTAACAGGCCAAGAGCTGTT No data
Right 929269829 2:39960810-39960832 GCAGTTATCTGCAGAAAATAGGG No data
929269825_929269828 12 Left 929269825 2:39960774-39960796 CCAGTAACAGGCCAAGAGCTGTT No data
Right 929269828 2:39960809-39960831 AGCAGTTATCTGCAGAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929269825 Original CRISPR AACAGCTCTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr