ID: 929274562

View in Genome Browser
Species Human (GRCh38)
Location 2:40011449-40011471
Sequence ACGCAATAAACAATGATGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929274562_929274564 23 Left 929274562 2:40011449-40011471 CCCTTCATCATTGTTTATTGCGT No data
Right 929274564 2:40011495-40011517 TTCTTTATTAGTCTTGCTAGCGG 0: 4899
1: 2647
2: 1728
3: 1345
4: 2229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929274562 Original CRISPR ACGCAATAAACAATGATGAA GGG (reversed) Intergenic
No off target data available for this crispr