ID: 929275960

View in Genome Browser
Species Human (GRCh38)
Location 2:40025109-40025131
Sequence ACGCAATAAACAATGATGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929275957_929275960 28 Left 929275957 2:40025058-40025080 CCAAAATTGATAGACCGCTAGCA No data
Right 929275960 2:40025109-40025131 ACGCAATAAACAATGATGAAGGG No data
929275958_929275960 14 Left 929275958 2:40025072-40025094 CCGCTAGCAAGACTAATAAGAGA No data
Right 929275960 2:40025109-40025131 ACGCAATAAACAATGATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929275960 Original CRISPR ACGCAATAAACAATGATGAA GGG Intergenic
No off target data available for this crispr