ID: 929278449

View in Genome Browser
Species Human (GRCh38)
Location 2:40050927-40050949
Sequence ATGCCACTCTAGTAGAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929278444_929278449 10 Left 929278444 2:40050894-40050916 CCATCAGTGAGTCTTACGGAAAC No data
Right 929278449 2:40050927-40050949 ATGCCACTCTAGTAGAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929278449 Original CRISPR ATGCCACTCTAGTAGAGGGA GGG Intergenic
No off target data available for this crispr