ID: 929285023

View in Genome Browser
Species Human (GRCh38)
Location 2:40126164-40126186
Sequence CAGAGCATGGAGTTGTTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 143}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929285023_929285027 23 Left 929285023 2:40126164-40126186 CCAGATAACAACTCCATGCTCTG 0: 1
1: 0
2: 1
3: 6
4: 143
Right 929285027 2:40126210-40126232 ACTAACTCTCAGGGCTGCTGTGG 0: 1
1: 0
2: 5
3: 27
4: 222
929285023_929285026 14 Left 929285023 2:40126164-40126186 CCAGATAACAACTCCATGCTCTG 0: 1
1: 0
2: 1
3: 6
4: 143
Right 929285026 2:40126201-40126223 TCTACGCTGACTAACTCTCAGGG 0: 1
1: 0
2: 0
3: 4
4: 54
929285023_929285028 24 Left 929285023 2:40126164-40126186 CCAGATAACAACTCCATGCTCTG 0: 1
1: 0
2: 1
3: 6
4: 143
Right 929285028 2:40126211-40126233 CTAACTCTCAGGGCTGCTGTGGG 0: 1
1: 2
2: 8
3: 38
4: 317
929285023_929285025 13 Left 929285023 2:40126164-40126186 CCAGATAACAACTCCATGCTCTG 0: 1
1: 0
2: 1
3: 6
4: 143
Right 929285025 2:40126200-40126222 ATCTACGCTGACTAACTCTCAGG 0: 1
1: 0
2: 0
3: 3
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929285023 Original CRISPR CAGAGCATGGAGTTGTTATC TGG (reversed) Intronic
901449148 1:9325528-9325550 CAGAGCATGGTGGTGTGAGCAGG + Intronic
909595953 1:77406298-77406320 CAGAGCCTGGAGATGTTTCCAGG + Intronic
912339707 1:108900532-108900554 CCCAGCCTGGAATTGTTATCAGG + Intronic
913485655 1:119330640-119330662 CAGAGCCTGCAGTTGTCCTCTGG + Intergenic
913538332 1:119795575-119795597 CAGAGCGAGGAGTTGTTCCCTGG + Intronic
916340062 1:163723413-163723435 CAGAGTTTGGTCTTGTTATCTGG - Intergenic
917032033 1:170703711-170703733 CAGGGCATGCAGCTGATATCTGG - Intronic
917489737 1:175487991-175488013 GAGAGCATTGAGCTGTTTTCTGG + Intronic
917628251 1:176867393-176867415 TAGAGAATGGAGTTGATATTAGG + Intronic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
918480988 1:184976282-184976304 TAAATCATTGAGTTGTTATCTGG - Intergenic
919008790 1:191932479-191932501 TATAGCATTAAGTTGTTATCAGG + Intergenic
919184126 1:194121765-194121787 AAGAGCATGGTGTTGATGTCTGG + Intergenic
1064301990 10:14131062-14131084 AAGAACATGGAGGTGTTACCTGG - Intronic
1066382897 10:34916831-34916853 CAGAGCTTGGAGTTAATGTCAGG + Intergenic
1071958972 10:90789786-90789808 CAGAACATGGATTTGAAATCTGG - Intronic
1075717798 10:124566970-124566992 CAGTGCCTGGAGATGTCATCTGG - Intronic
1076168887 10:128303913-128303935 CAGAGCATGGGGATGTGGTCAGG - Intergenic
1076671365 10:132122546-132122568 CAGAGCATGGAGGCTTTAACAGG + Intronic
1078734056 11:14003405-14003427 CAGGGTATGGAGTTTTTATGAGG + Intronic
1080614353 11:33933013-33933035 GAGAGAATGGAGGTGCTATCAGG - Intergenic
1081319825 11:41678693-41678715 CAGAGCATGGAGTTCCTCTTTGG - Intergenic
1086494721 11:87390162-87390184 CCTATCATGAAGTTGTTATCTGG - Intergenic
1086590860 11:88511920-88511942 CAAAGCATGGACTTGAAATCAGG + Intronic
1087311744 11:96551875-96551897 CAGAGCAGAGAGTTGTAATGAGG - Intergenic
1091306839 11:134541751-134541773 CTGAGCATGGAGATGTTAAGTGG + Intergenic
1093551796 12:20421407-20421429 CACAGTCTTGAGTTGTTATCTGG - Intronic
1094142810 12:27198399-27198421 CAGATCCTGGAGCTGTGATCAGG - Intergenic
1099194952 12:79604679-79604701 CAGAGCAAGGAGCTGTTACGAGG - Intronic
1100748414 12:97670718-97670740 CAGAGAAGGGAGTGGTTATAAGG + Intergenic
1102633004 12:114298681-114298703 CAGAAGATGGAGGGGTTATCTGG - Intergenic
1104610093 12:130220585-130220607 CAGAGCATGGAGGGATTAGCTGG - Intergenic
1106483347 13:30153310-30153332 GAGAGAATGGGATTGTTATCAGG + Intergenic
1108018763 13:46103456-46103478 CAGTGCATGGAGTTGAAATGAGG + Intronic
1108283426 13:48881967-48881989 CAGAGCCTGGATTTGAAATCAGG - Intergenic
1111990240 13:95109087-95109109 TAGAGCATGGAGCAGTTAACTGG - Intronic
1121120098 14:91371163-91371185 CAGTGCTTGGAGTTGATATAAGG + Intronic
1124723519 15:32133997-32134019 CAGAGCATGGAATATTTGTCAGG - Intronic
1125066392 15:35490892-35490914 AAGAGCATGGTGTTGGAATCTGG + Intronic
1126469024 15:48987164-48987186 CAAAGAATGGAATTGTGATCTGG - Intergenic
1127836272 15:62793608-62793630 CAGAGTATGGCGTGGTTAACTGG - Intronic
1128605485 15:69033620-69033642 CAGACCATGGAGTTGGAATGTGG + Intronic
1131469811 15:92686931-92686953 CAGAGGGTAAAGTTGTTATCAGG - Intronic
1141844560 16:86598631-86598653 CAGAGAATGGAGTTATGTTCAGG - Intergenic
1145838341 17:27971989-27972011 CAGAGCAGGGAGCTCTTACCTGG - Intergenic
1147310210 17:39591582-39591604 CAGGCCCTGGAGTTGTCATCAGG - Intergenic
1149058535 17:52393161-52393183 CAGAGCTTCGAGTTCTCATCAGG + Intergenic
1150824128 17:68459626-68459648 CAAATCATAGAGTTGTTTTCAGG + Intergenic
1155306818 18:24486774-24486796 CATAGCATGGAGTGGTTACTAGG + Intergenic
1157788511 18:50508346-50508368 CAGAACATGCAGTTTTTAACTGG - Intergenic
1157935817 18:51872061-51872083 CCTATCATGAAGTTGTTATCTGG + Intergenic
1157989318 18:52475976-52475998 TAGTGCATGCAGCTGTTATCTGG - Intronic
1159315970 18:66773426-66773448 CAGAGGATGGATTTGTTTTCTGG + Intergenic
1165297449 19:34939049-34939071 CAGAGTATGGAGCTGCCATCAGG + Intronic
1166622480 19:44314282-44314304 CAGGGTATGGAGTTTTTATGGGG - Intergenic
1167732961 19:51272233-51272255 CAGAGATAGGATTTGTTATCTGG + Intergenic
929285023 2:40126164-40126186 CAGAGCATGGAGTTGTTATCTGG - Intronic
929754911 2:44756395-44756417 AAAACCATGGAGTTGTTGTCTGG - Intronic
931457067 2:62418742-62418764 CAGAGTGTTAAGTTGTTATCAGG + Intergenic
933545150 2:83700758-83700780 CAGAGAATAGAGTTCTTCTCAGG + Intergenic
935597202 2:104888558-104888580 CAAGGCATGGTTTTGTTATCTGG + Intergenic
939300990 2:140338293-140338315 CAGAGGGTGGAGATGTTACCAGG + Intronic
939566317 2:143790195-143790217 CACAGGATGAAGTTGTTCTCCGG - Intergenic
948838649 2:240638228-240638250 CAGAGTGTGTAGTTGTGATCGGG - Intergenic
949076286 2:242060777-242060799 CAGAGCAGAGAGTTGGTGTCAGG + Intergenic
1168740258 20:183514-183536 CCTATCATGGAGTTGTTAGCTGG - Intergenic
1168961489 20:1873011-1873033 AAGAGCATGGAGCTGGCATCTGG - Intergenic
1170469708 20:16656068-16656090 CAGAGCATGGAGTTGGTAGTGGG + Intergenic
1173051392 20:39565546-39565568 CAGAGCATGGCATATTTATCAGG - Intergenic
1173302091 20:41812949-41812971 CAGGGCATGGAGTTCATATGAGG + Intergenic
1174518638 20:51112995-51113017 CAAAGCATGGAGTACTTTTCAGG + Intergenic
1175015596 20:55786688-55786710 AAGAATATGGAGTTGTTTTCTGG + Intergenic
1178789499 21:35686985-35687007 TAGAGCTTGGACATGTTATCAGG - Intronic
1179082193 21:38181686-38181708 CAGAGTATGGAGTTCATAACTGG + Intronic
1181792744 22:25280880-25280902 CAGAGCAGGGACTTGATTTCAGG + Intergenic
1181813281 22:25418472-25418494 CAGAGCAGGGATTTGATTTCAGG + Intergenic
1181831307 22:25562936-25562958 CAGAGCAGGGATTTGATTTCAGG + Intergenic
1181839952 22:25648280-25648302 CAGAGTATCAAGTTGTTCTCTGG - Intronic
1183074090 22:35415781-35415803 CAAAGCATGGAGTTGTTATTGGG + Intronic
1184981433 22:48098653-48098675 CTCAGCATGGAGTTTTTTTCAGG - Intergenic
952202490 3:31145904-31145926 AAGGGCATTAAGTTGTTATCAGG - Intergenic
952636051 3:35533343-35533365 CAAAGCTTGTAGTTTTTATCAGG - Intergenic
956969503 3:74506054-74506076 CAAAGCATGGAGATTTTACCAGG + Intronic
958445811 3:94213635-94213657 AAGAGCATGGCATTGATATCTGG + Intergenic
959615406 3:108341919-108341941 CAGAGCATTGATTTGATGTCTGG - Intronic
960681064 3:120248009-120248031 AAGAGCATTGAGTTGTGTTCTGG - Intronic
961907154 3:130274760-130274782 CACAGGATGGAGTTGCTCTCTGG + Intergenic
962848975 3:139293808-139293830 CACAACATGGGGTTGTTATCAGG + Intronic
963004938 3:140718210-140718232 CAGAAGATGGAATTCTTATCTGG + Intergenic
965838104 3:172873471-172873493 CAGAGCATGGTGCTGGCATCTGG + Intergenic
967678759 3:192334162-192334184 CACAGGATGAAGTTGTTCTCTGG - Intronic
968177915 3:196567560-196567582 CAGCTCATGGAGTTGTTTTGAGG + Intronic
971251144 4:24974452-24974474 CAGAGCTGGGAGTTGACATCAGG - Intronic
973034066 4:45383721-45383743 CAGAGTATGGAGGTGTCATATGG - Intergenic
978561709 4:110041044-110041066 CACTGCATAGAGTTGTTATGAGG - Intergenic
978578213 4:110207317-110207339 TATTGCATGGAGTTGTTATAAGG - Intergenic
983713789 4:170753256-170753278 CATATCATGAAGTTGTTAGCTGG + Intergenic
984160091 4:176241849-176241871 GAGAGAATGGAGTGGTGATCTGG + Intronic
985161155 4:187046298-187046320 CACAGCATAGAGGTCTTATCAGG - Intergenic
990044166 5:51408546-51408568 AAGAGTACGGAGGTGTTATCTGG - Intergenic
991515375 5:67428974-67428996 CAGAGCATGTATTTTTTAACAGG + Intergenic
992154803 5:73944747-73944769 AAGAGCATGGTGTTGGCATCTGG - Intergenic
993453330 5:88098889-88098911 AAGAGCATGGTGCTGTCATCTGG - Intergenic
994477120 5:100285596-100285618 AATAGCATTGAGTTGTTTTCAGG - Intergenic
996199668 5:120656004-120656026 CAGAGCATGCAGTTGCCACCAGG + Intronic
997650138 5:135511103-135511125 CTGAGCATGCAGGTGTCATCAGG - Intergenic
998448149 5:142214190-142214212 CTGACCATGGAGTGGTGATCGGG + Intergenic
998768164 5:145511774-145511796 CTGACCATTGAGTTGTTACCAGG - Intronic
1001749155 5:174115637-174115659 CATAGCATGGAGTTGTTTCCAGG + Intronic
1002171795 5:177378796-177378818 CAGAGCCTGGAGTTCCTAGCCGG + Intergenic
1005658888 6:27973701-27973723 CAGAACATGTATATGTTATCTGG - Intergenic
1007287190 6:40756054-40756076 CAGATCATGGGGTTGTTATAAGG - Intergenic
1010120117 6:72365354-72365376 CAGAACTTGGAGTATTTATCTGG - Intronic
1011015688 6:82752053-82752075 TAGAGCATGTAGGTGTTTTCTGG - Intergenic
1011936504 6:92785073-92785095 GAGAGCATGGAACTGGTATCTGG - Intergenic
1011996312 6:93593332-93593354 CAGAGATTGGTTTTGTTATCAGG + Intergenic
1020133537 7:5573330-5573352 CAGAGAAGGGAGTTGTAAACTGG - Intergenic
1022634406 7:32118601-32118623 CAGAGCATGGTGCTGGCATCTGG + Intronic
1023844253 7:44112211-44112233 CAGAGCACAGAGTTGAGATCCGG - Exonic
1028733464 7:94179674-94179696 CAGAGCAAGGCCTTGATATCAGG + Intergenic
1029168227 7:98611460-98611482 AAGAGCATGGTGCTGGTATCTGG - Intergenic
1030370254 7:108691987-108692009 CAGAGTGTTAAGTTGTTATCAGG - Intergenic
1032158493 7:129490958-129490980 AAGAGCATGGCGCTGGTATCTGG + Intergenic
1032528727 7:132602366-132602388 TAGAGCATGTAGCTGTCATCTGG - Intronic
1032866537 7:135931023-135931045 TAGAGCATGGAGCGGTTAACTGG - Intronic
1033147167 7:138881331-138881353 CAGAGCATGCTTCTGTTATCAGG - Intronic
1033192458 7:139294445-139294467 CAGATCAAGCATTTGTTATCTGG - Intronic
1034250874 7:149689653-149689675 CAGAGCCTGGGGTGGTTTTCTGG + Intergenic
1035650544 8:1260824-1260846 CAGAGCATGGGGAGGTGATCTGG + Intergenic
1042541811 8:69915063-69915085 AAGAGCATGGTGTTGGCATCTGG + Intergenic
1042788585 8:72578068-72578090 CAGAGCATGTAGTTTTATTCAGG + Intronic
1045895836 8:107215569-107215591 CAGAGCTTGTAGTAGTTAACTGG - Intergenic
1047746738 8:127850721-127850743 AAGAACATGTAGTTGTGATCAGG + Intergenic
1047816639 8:128471646-128471668 CAGACCATGCATGTGTTATCTGG - Intergenic
1048036141 8:130679144-130679166 CTTAGCATCCAGTTGTTATCTGG + Intergenic
1049157506 8:141075804-141075826 CAGAGCAAGGATTTGGAATCGGG + Intergenic
1055664179 9:78536740-78536762 TAGAGGATGGAGCTGTTATCGGG + Intergenic
1057359402 9:94359557-94359579 CAGTGCATGCAGTTGTCAGCTGG + Intergenic
1057648363 9:96898035-96898057 CAGTGCATGCAGTTGTCAGCTGG - Intergenic
1059957682 9:119535217-119535239 CAGAGCATGGAGGTCTTCGCAGG + Intergenic
1060770641 9:126329387-126329409 CAGATCATGGTGTTTTTTTCAGG + Intronic
1187849341 X:23575957-23575979 CAAAGAATGCAGTGGTTATCAGG + Intergenic
1191667508 X:63718566-63718588 CATAGCATGGATTTGTAACCTGG - Intronic
1195453091 X:105037586-105037608 CAGAGCATGGATATGGAATCAGG - Intronic
1195558578 X:106256450-106256472 AATAGCATTAAGTTGTTATCAGG - Intergenic
1195742164 X:108075788-108075810 GACACCATGGAGTTGTGATCTGG - Intronic
1196045167 X:111249151-111249173 CAGAGCCTTGAGTTATTTTCTGG + Intronic
1197574660 X:128197037-128197059 CATCTCATGGAGTTGTTATGAGG - Intergenic
1197673122 X:129300313-129300335 AAGAGCATGGTGTTGGCATCTGG - Intergenic
1199156949 X:144561182-144561204 AAGACAATGGTGTTGTTATCTGG + Intergenic
1200319942 X:155177437-155177459 CAGGGGATGGAGTTTTTATTAGG + Intergenic