ID: 929295930

View in Genome Browser
Species Human (GRCh38)
Location 2:40246636-40246658
Sequence TTCCTTATGAAAGGTCTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 380}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929295930_929295932 11 Left 929295930 2:40246636-40246658 CCAAACAGACCTTTCATAAGGAA 0: 1
1: 0
2: 0
3: 18
4: 380
Right 929295932 2:40246670-40246692 ACTTCATTAATTCCAGAAGATGG 0: 1
1: 0
2: 1
3: 15
4: 200
929295930_929295933 15 Left 929295930 2:40246636-40246658 CCAAACAGACCTTTCATAAGGAA 0: 1
1: 0
2: 0
3: 18
4: 380
Right 929295933 2:40246674-40246696 CATTAATTCCAGAAGATGGATGG 0: 1
1: 1
2: 1
3: 15
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929295930 Original CRISPR TTCCTTATGAAAGGTCTGTT TGG (reversed) Intronic
901198962 1:7456029-7456051 TTCCTTATCAACAGCCTGTTAGG - Intronic
905949577 1:41937770-41937792 TTGCTTAAGAAAGTTCTGATTGG + Intronic
906519168 1:46457182-46457204 TTCATCATGACAGGTCCGTTAGG - Intergenic
906817847 1:48897771-48897793 TCCTTTAAGAAATGTCTGTTCGG + Intronic
907534065 1:55132498-55132520 TTCATTTTGACAGGTCTATTTGG - Intronic
910989717 1:93042528-93042550 TTCCTATGGAAAGGTCTGATTGG + Intergenic
911154221 1:94623214-94623236 TTCATAAGGAAAGTTCTGTTAGG - Intergenic
911418047 1:97600637-97600659 TTCCTCATCACAGGACTGTTGGG + Intronic
913932538 1:124993865-124993887 TTCCTGTTGAAAGAGCTGTTTGG - Intergenic
915799979 1:158780499-158780521 TTCATTATGATAGGTTTATTGGG - Intergenic
916272751 1:162961523-162961545 TTACTTATGAATGATCTGTGGGG - Intergenic
916475405 1:165164066-165164088 CTCCTTAGGCAAGGTCTGGTAGG + Intergenic
916636717 1:166678233-166678255 TCCCTTAAGAAAAGTATGTTTGG - Intergenic
917106581 1:171498405-171498427 TGCCTTATGAAAGGGCTGGAGGG - Intronic
920305281 1:205014622-205014644 TCCCTTAGGAGAGGTCTGTTCGG + Intronic
921379735 1:214512263-214512285 TTCCTTAGGAAAGGTGAGGTAGG - Intronic
922890224 1:229056354-229056376 TTACTTATGAATGGTCTGTGGGG + Intergenic
1065150777 10:22820813-22820835 TTCCTCATCAAATGTTTGTTAGG + Intergenic
1065249595 10:23797195-23797217 TTCCTGATGAAGGGTCTGAGTGG + Intronic
1067334993 10:45354030-45354052 ATCCTAAGGAAAAGTCTGTTAGG + Intergenic
1067770719 10:49121736-49121758 ATTCTCATGAAAGGTCTGTCAGG + Intergenic
1071467232 10:85952070-85952092 TTGTTTTTGAAAGGTTTGTTTGG - Intronic
1071716453 10:88101163-88101185 TTCCTTATGAAAAGTCTGGGTGG + Intergenic
1071743264 10:88386547-88386569 TTCCTTATCAAACGTCTTTAGGG + Intronic
1073546147 10:104350893-104350915 CTACTTATGAAAGCTCTTTTAGG + Intergenic
1075463403 10:122633373-122633395 TCCCTCTTGAAAGGTCTGTGGGG - Intronic
1075463416 10:122633438-122633460 TCCCTCTTGAAAGGTCTGTGGGG - Intronic
1077475292 11:2786719-2786741 TTATTTATAAAAGTTCTGTTGGG + Intronic
1078852749 11:15179316-15179338 TTCATTATGAAAGGTATTTATGG + Intronic
1079620358 11:22547270-22547292 TTACAGATGAAAAGTCTGTTTGG + Intergenic
1080281596 11:30563509-30563531 TACCTTAAGAATGGTTTGTTGGG - Intronic
1080442993 11:32312632-32312654 TTCCTTATGAAACATCCCTTCGG - Intergenic
1081179997 11:39973343-39973365 TTCCTTAAGAAATGCCTTTTGGG + Intergenic
1082554804 11:54551564-54551586 TTCCTTTTGAAAGAGCAGTTTGG + Intergenic
1086045086 11:82523455-82523477 TGCCTTATGCACAGTCTGTTAGG - Intergenic
1086548015 11:88021401-88021423 TTACTTATTATTGGTCTGTTTGG - Intergenic
1086925484 11:92635858-92635880 TTCCTTATGAAAACTATATTGGG + Intronic
1087019721 11:93589875-93589897 TACCTTATTAAAGGACTCTTGGG - Intergenic
1090392440 11:126397801-126397823 TTCCTTATAAAAGGACAATTAGG - Intronic
1090392791 11:126400288-126400310 TTCCTTATAAAAGGCCAGTTAGG - Intronic
1090703753 11:129318042-129318064 TTCCTTATTAAAGGGCTGGAGGG + Intergenic
1091527772 12:1321586-1321608 TTCCTGATGAATGTTCTCTTTGG + Intronic
1092978302 12:13767824-13767846 TTCTTGATGAGAGGTCTTTTGGG - Intronic
1097729678 12:63114226-63114248 TTTCTTATTATTGGTCTGTTCGG - Intergenic
1098141452 12:67453920-67453942 TCCCCTACCAAAGGTCTGTTGGG + Intergenic
1098449125 12:70599579-70599601 TTCCATATTTCAGGTCTGTTGGG - Intronic
1099848379 12:88058732-88058754 TTCCTGATGAACAGTTTGTTTGG - Intronic
1100145293 12:91670313-91670335 TTCCTCTTGAAAAGTCTATTTGG + Intergenic
1102387537 12:112522363-112522385 TGCCTTATGAAAAGTTTGTGGGG + Intergenic
1103753073 12:123180487-123180509 TTCTTTTTGAAAGCTCTGTTTGG - Intronic
1105568162 13:21572629-21572651 TTACTTATGAATAGTCTGTGGGG + Intronic
1105700470 13:22932207-22932229 TTCCTTGTGAAATGTGTGCTGGG - Intergenic
1105853239 13:24354254-24354276 TTCCTTGTGAAATGTGTGCTGGG - Intergenic
1106789287 13:33138482-33138504 TTCTTTATGGAATGTCTGGTTGG - Intronic
1107566768 13:41613195-41613217 TTCCTTATGAAAGTCCAGGTAGG + Intronic
1108920917 13:55673229-55673251 TTACTTATGAATGATCTGTGAGG + Intergenic
1109237582 13:59843566-59843588 CTCTTTATGAAATGTCTGTGAGG - Intronic
1109761698 13:66838223-66838245 TTCTTCTTGAAAGGTCTCTTTGG + Intronic
1110354902 13:74555993-74556015 TTCTTTCTGAAAGGCATGTTGGG - Intergenic
1111604699 13:90521889-90521911 TCTCTTATGACAGGTCTGGTAGG - Intergenic
1111698628 13:91658417-91658439 TTCTTTTTCAAAGATCTGTTAGG + Intronic
1112544696 13:100354810-100354832 TTACTTATGATAAGTCTATTCGG - Intronic
1113505900 13:110815648-110815670 TTCCTTTTGAGAGGCCTGTAGGG + Intergenic
1114586414 14:23817825-23817847 GTCCTTGTGAAAGAACTGTTGGG + Intergenic
1114953073 14:27781527-27781549 TTTCTTATGAAAAGTTTATTTGG + Intergenic
1115945460 14:38654682-38654704 TTCCATCTCAAAGGTTTGTTTGG + Intergenic
1117249194 14:53918429-53918451 GACCTTATGAAAGGTCTGGCGGG - Intergenic
1120278423 14:82408313-82408335 TTCCCTATGAAAGAACTATTAGG + Intergenic
1120721355 14:87892712-87892734 TGCCTTATGAAAGGGCTGGAGGG - Intronic
1122449283 14:101791664-101791686 TCATTTATGAAAGTTCTGTTTGG + Intronic
1123471490 15:20557452-20557474 TTCCTTATAAAAGGGCTTGTGGG + Intergenic
1123646513 15:22442903-22442925 TTCCTTATAAAAGGGCTTGTGGG - Intergenic
1123731792 15:23152454-23152476 TTCCTTATAAAAGGGCTTGTGGG + Intergenic
1123749929 15:23349836-23349858 TTCCTTATAAAAGGGCTTGTGGG + Intergenic
1124282297 15:28373732-28373754 TTCCTTATAAAAGGGCTTGTGGG + Intergenic
1124300404 15:28537883-28537905 TTCCTTATAAAAGGGCTTGTGGG - Intergenic
1126080260 15:44953958-44953980 TTGTTTTTGAAAGGTCTGATAGG + Intergenic
1126335695 15:47584118-47584140 TTACACATGAAAGTTCTGTTAGG - Intronic
1126381526 15:48052650-48052672 AACCTAATGAAAGGTATGTTAGG + Intergenic
1126912889 15:53433818-53433840 TTCCTTATGAAAAGCTTATTTGG - Intergenic
1127362687 15:58258998-58259020 TACCTTATGAAAGGGCTGGAGGG - Intronic
1130423504 15:83772626-83772648 ATCCTTATGCAAGGTTTCTTGGG + Intronic
1133323030 16:4926038-4926060 TTCCGCCTGAAAGGTCTGTTTGG - Intronic
1137781725 16:51103221-51103243 TTCCTTGAGAAAGGCCTGGTGGG + Intergenic
1140378279 16:74463119-74463141 TTCCTTCTGAACGTTCTTTTAGG + Intronic
1144619738 17:16810035-16810057 TTCCTAATGTCAGGTATGTTTGG + Intergenic
1144892949 17:18505669-18505691 TTCCTAATGTCAGGTATGTTTGG - Intergenic
1145139268 17:20438623-20438645 TTCCTAATGTCAGGTATGTTTGG + Intergenic
1145687082 17:26680821-26680843 TTCCTTTTGAAAGAGCAGTTTGG + Intergenic
1147504595 17:41003146-41003168 TTCTTTATGAAGGGGATGTTTGG - Intergenic
1149133572 17:53338201-53338223 TGCCTTATAAGAGGTCTGTAAGG + Intergenic
1157307183 18:46525748-46525770 TTCCTTCTGAAAGATTTGCTGGG + Intronic
1158924287 18:62236502-62236524 TTCCTTGTTATAAGTCTGTTGGG + Intronic
1159957720 18:74531583-74531605 TGCCTTATGAAAGGTATGGAAGG + Intergenic
1161066263 19:2239776-2239798 TCCTTTATGAAAGATTTGTTTGG + Intronic
1161836742 19:6652800-6652822 TTCCTGAGGAAAGATCTGTGGGG - Intergenic
1164359652 19:27490377-27490399 TTCCTTTTGAATGGGCAGTTTGG + Intergenic
1165820942 19:38675720-38675742 TTCCTGATGAAAGGTCAGCTGGG + Intronic
1165966999 19:39590337-39590359 TGCCTTCTGAAAGGTCTGTAGGG + Intergenic
1165972693 19:39645890-39645912 TACCTTTTGAAAGGTCTGTAGGG + Intergenic
1165978584 19:39699597-39699619 TGCCTTCTGAAAGGTCTGGAGGG + Intergenic
1168166779 19:54554138-54554160 TTCCTTATGAATGATGTGTGAGG + Intergenic
925847359 2:8045779-8045801 TTCCTTACTAAAGTTCTGTCAGG + Intergenic
927837655 2:26413359-26413381 TTCCTAAAGAAAGGATTGTTGGG + Intronic
929295930 2:40246636-40246658 TTCCTTATGAAAGGTCTGTTTGG - Intronic
930119692 2:47750291-47750313 TTCCTTATGAAAGTTCTAGCAGG + Intronic
930457300 2:51621592-51621614 CTCCTTAATAAAGTTCTGTTGGG + Intergenic
931008411 2:57879607-57879629 TTTCTTAAGAAAGGTCAGTGGGG - Intergenic
931015953 2:57981201-57981223 TGCCTTATGAAAGGTCCTTAAGG - Intronic
933839537 2:86275428-86275450 TTGCATATGAAAGGTGTGCTGGG - Intronic
934489206 2:94747577-94747599 ATCCTTATGAAAACACTGTTTGG + Intergenic
939322192 2:140638574-140638596 TTCCTAAATAAAGGTATGTTTGG + Intronic
940669151 2:156646280-156646302 TTCTTTAAGAAAAGTCTATTAGG - Intergenic
941353828 2:164465121-164465143 TCCCTTATGAAAGGGCTGGAAGG - Intergenic
941628560 2:167858405-167858427 TTCCTTATGAAACATCTTATAGG + Intergenic
942413692 2:175736770-175736792 TTCCTTAAGAAAGGCATGCTAGG - Intergenic
944435654 2:199686497-199686519 TAGCTTATCAAATGTCTGTTTGG - Intergenic
946143063 2:217707739-217707761 TTGCTTAAGAAATGTTTGTTTGG + Intronic
947958292 2:234213462-234213484 TTCCTAATGAAAGGTGTCTGGGG - Intergenic
1169419935 20:5451886-5451908 TTACTTATGAATGATCTGTGGGG + Intergenic
1170668892 20:18411973-18411995 TGCCTTATGAAAGGGCTGGAGGG - Intronic
1171177242 20:23061651-23061673 TTCCTTTGGAAAGGACTTTTGGG + Intergenic
1174995857 20:55567424-55567446 TTCCTTTTGAAATCTCTGTGTGG - Intergenic
1177087392 21:16723652-16723674 TTCTTTAGGAAAGGTCACTTAGG - Intergenic
1181898807 22:26135381-26135403 GTCCTTATAAAAGGGCTATTTGG + Intergenic
950832345 3:15887316-15887338 CTCCTTATCAAATGTTTGTTTGG - Intergenic
950877225 3:16287158-16287180 TTCCCTAGGAAAGGTGTGTTTGG + Intronic
950998382 3:17529373-17529395 TTCCTTATGTGAGGTCTTGTTGG + Intronic
954477593 3:50762826-50762848 TTCCTTGTGATATGTTTGTTTGG + Intronic
954858998 3:53671669-53671691 TCCCTTATGAAACACCTGTTTGG - Intronic
955454687 3:59106924-59106946 TGCCTTATAAAAGGTCTGGAGGG - Intergenic
956016554 3:64889907-64889929 TTCCTTAAAAAAGATCTTTTTGG + Intergenic
957163391 3:76639593-76639615 GTACTTTTTAAAGGTCTGTTAGG - Intronic
958115764 3:89215942-89215964 TTCCTTATCAAATGGCTGTGGGG + Intronic
958443376 3:94183972-94183994 TTCCATATAACAGCTCTGTTTGG - Intergenic
958453285 3:94300297-94300319 GTCCTCAGGAAAGGTCTTTTTGG - Intergenic
958923636 3:100134120-100134142 TTTCTTATGAAATTTCTGTTCGG + Intronic
960301168 3:116004711-116004733 TTTCTTATGAAAGGTCAATAGGG + Intronic
960428268 3:117536074-117536096 TGCCTAATGACAGGTCTGTGCGG + Intergenic
962361005 3:134742742-134742764 TTCTTAATGAAAGGGCTTTTGGG + Intronic
963223541 3:142837196-142837218 TTCCTTCTGAAAGCTCTGAAAGG - Intronic
964693635 3:159482158-159482180 TTCCTTGAGAAAGGTATGTTGGG + Intronic
965057448 3:163740500-163740522 TTCCTTATTAATTTTCTGTTTGG - Intergenic
965290215 3:166869068-166869090 TTCTTTATCAAAGATCAGTTGGG + Intergenic
965539429 3:169857641-169857663 TTCCTAAGGACAGATCTGTTTGG - Intronic
965950811 3:174305783-174305805 ATCCTTATAAAAGGTCTGGAGGG - Intergenic
966459407 3:180159298-180159320 TTACTTATTATTGGTCTGTTTGG + Intergenic
967253430 3:187566051-187566073 TCCATGATGAAAGGTCTTTTTGG - Intergenic
967602645 3:191407440-191407462 TTTCTTACTACAGGTCTGTTGGG + Intergenic
970607031 4:17690605-17690627 TTCCTTATGGAAAGTCTGGAAGG - Intronic
971742000 4:30533207-30533229 ATCCGTATGCAAGTTCTGTTTGG + Intergenic
972443774 4:39123182-39123204 TTACTTGTTACAGGTCTGTTTGG - Intronic
973271735 4:48269466-48269488 TTCCTTAGGAGAGGTCAGTGCGG + Intronic
974276731 4:59730052-59730074 TTCTTTGTGAAAGATCAGTTGGG - Intergenic
975260610 4:72293268-72293290 TAACTAATGAAAAGTCTGTTTGG + Intronic
977997510 4:103513190-103513212 TTCCTTATAAAAGGTCTATAAGG - Intergenic
978133371 4:105226858-105226880 AACCTTTTGAAAGGTATGTTAGG - Intronic
978923508 4:114215964-114215986 TTTCTTATAAAAGGACAGTTGGG - Intergenic
979748189 4:124243469-124243491 TTCCTTATCAAACGTTTGTATGG - Intergenic
979849316 4:125556686-125556708 TCCCTTATGAAAGGGTTGCTTGG + Intergenic
980607317 4:135109941-135109963 TTATTTCTGAAAGCTCTGTTCGG + Intergenic
981920022 4:150077439-150077461 TTCTTCCTGAAAGGTCAGTTTGG + Intergenic
982237389 4:153264212-153264234 TTCCATATGAAAACTCTTTTTGG + Intronic
983677364 4:170311377-170311399 TTCCTTATTAAAGGTCTACGTGG + Intergenic
986244660 5:5996235-5996257 TGCCTTATGAGAGGTCTTTAAGG - Intergenic
988892089 5:35628989-35629011 TTCCATATCAATGGTCTGCTTGG - Intronic
989304076 5:39931371-39931393 TTCCTTATGAGAGCTGTGATCGG + Intergenic
989387855 5:40871266-40871288 TTACTTATGAATGATCTGTGAGG + Intergenic
989902807 5:47203479-47203501 TTCCTTTTCAAAGAGCTGTTGGG + Intergenic
989915759 5:49725451-49725473 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989915897 5:49727665-49727687 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989916040 5:49729879-49729901 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989916193 5:49732091-49732113 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989916501 5:49736521-49736543 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989916788 5:49740947-49740969 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989916933 5:49743162-49743184 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989917085 5:49745379-49745401 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989917235 5:49747597-49747619 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989917378 5:49749810-49749832 TTCCTTTTGATAGGGCAGTTCGG + Intergenic
989917526 5:49752025-49752047 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989917676 5:49754239-49754261 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989917784 5:49755943-49755965 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989917929 5:49758158-49758180 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989918231 5:49762588-49762610 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989918393 5:49764805-49764827 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989918544 5:49767021-49767043 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989918829 5:49771450-49771472 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989918980 5:49773666-49773688 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989919126 5:49775883-49775905 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989919433 5:49780314-49780336 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989919587 5:49782528-49782550 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989919887 5:49786956-49786978 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989920030 5:49789171-49789193 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989920338 5:49793601-49793623 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989920491 5:49795815-49795837 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989920643 5:49798034-49798056 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989920796 5:49800250-49800272 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989920948 5:49802468-49802490 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989921095 5:49804682-49804704 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989921244 5:49806897-49806919 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989921408 5:49809112-49809134 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989921562 5:49811328-49811350 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989921866 5:49815755-49815777 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989922016 5:49817969-49817991 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989922160 5:49820015-49820037 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989922305 5:49822229-49822251 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989922451 5:49824445-49824467 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989922602 5:49826658-49826680 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989922895 5:49831085-49831107 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989923035 5:49833305-49833327 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989923330 5:49837728-49837750 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989923474 5:49839941-49839963 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989923613 5:49842155-49842177 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989923768 5:49844370-49844392 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989923922 5:49846584-49846606 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989924080 5:49848799-49848821 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989924234 5:49851015-49851037 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989924385 5:49853228-49853250 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989924537 5:49855443-49855465 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989924692 5:49857659-49857681 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989924998 5:49862086-49862108 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989925150 5:49864300-49864322 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989925438 5:49868560-49868582 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989925590 5:49870774-49870796 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989925730 5:49872987-49873009 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989926025 5:49877418-49877440 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989926173 5:49879632-49879654 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989926332 5:49881848-49881870 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989926485 5:49884062-49884084 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989926622 5:49886275-49886297 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989926766 5:49888489-49888511 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989927073 5:49892919-49892941 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989927215 5:49895131-49895153 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989927375 5:49897346-49897368 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989927808 5:49903818-49903840 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989927967 5:49906033-49906055 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989928112 5:49908247-49908269 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989928262 5:49910463-49910485 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989928420 5:49912676-49912698 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989928566 5:49914889-49914911 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989928722 5:49917103-49917125 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989929019 5:49921530-49921552 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989929162 5:49923743-49923765 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989929310 5:49925956-49925978 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989929585 5:49930213-49930235 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989929730 5:49932426-49932448 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989929879 5:49934642-49934664 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989930023 5:49936856-49936878 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989930180 5:49939070-49939092 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989930328 5:49941287-49941309 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989930626 5:49945718-49945740 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989930770 5:49947932-49947954 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989930912 5:49950148-49950170 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989931058 5:49952361-49952383 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989931209 5:49954571-49954593 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989931357 5:49956786-49956808 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989931506 5:49959001-49959023 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989931657 5:49961215-49961237 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989931808 5:49963429-49963451 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989931957 5:49965645-49965667 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989932110 5:49967858-49967880 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989932407 5:49972286-49972308 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989932559 5:49974500-49974522 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989932707 5:49976713-49976735 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989933471 5:49987786-49987808 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989933611 5:49990000-49990022 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989933902 5:49994430-49994452 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989934052 5:49996647-49996669 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989934200 5:49998862-49998884 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989934355 5:50001076-50001098 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989934506 5:50003293-50003315 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989934655 5:50005509-50005531 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989934807 5:50007726-50007748 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989934953 5:50009940-50009962 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989935244 5:50014370-50014392 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989935390 5:50016588-50016610 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989935542 5:50018802-50018824 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989935693 5:50021015-50021037 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989935845 5:50023228-50023250 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989935999 5:50025444-50025466 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989936300 5:50029875-50029897 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989936451 5:50032090-50032112 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989936603 5:50034304-50034326 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989936765 5:50036518-50036540 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989936918 5:50038733-50038755 TTCCTTTTGATAGGGCAGTTCGG + Intergenic
989937068 5:50040952-50040974 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989937228 5:50043168-50043190 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989937376 5:50045384-50045406 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989937520 5:50047598-50047620 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989937826 5:50052028-50052050 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989937967 5:50054245-50054267 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989938113 5:50056459-50056481 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
989938492 5:50112023-50112045 TTCCTTTTGATAGGGCAGTTTGG - Intergenic
989938634 5:50114237-50114259 TTCCTTTTGATAGGGCAGTTTGG - Intergenic
989938774 5:50116447-50116469 TTCCTTTTGATAGGGCAGTTTGG - Intergenic
989938920 5:50118661-50118683 TTCCTTTTGATAGGGCAGTTTGG - Intergenic
989939062 5:50120875-50120897 TTCCTTTTGATAGGGCAGTTTGG - Intergenic
989939204 5:50123089-50123111 TTCCTTTTGATAGGGCAGTTTGG - Intergenic
989939344 5:50125303-50125325 TTCCTTTTGATAGGGCAGTTTGG - Intergenic
989939485 5:50127517-50127539 TTCCTTTTGATAGGGCAGTTTGG - Intergenic
989939626 5:50129731-50129753 TTCCTTTTGATAGGGCAGTTTGG - Intergenic
989939768 5:50131945-50131967 TTCCTTTTGATAGGGCAGTTTGG - Intergenic
989939909 5:50134159-50134181 TTCCTTTTGATAGGGCAGTTTGG - Intergenic
989940066 5:50136713-50136735 TTCCTTTTGATAGGGCAGTTTGG - Intergenic
989940225 5:50139268-50139290 TTCCTTTTGATAGGGCAGTTTGG - Intergenic
989940377 5:50141822-50141844 TTCCTTTTGATAGGGCAGTTTGG - Intergenic
989940541 5:50144548-50144570 TTCCTTTTGATAGGGCAGTTTGG - Intergenic
990090879 5:52046959-52046981 TTCTTTCTGAAAGGCCTTTTCGG - Intronic
990220517 5:53583188-53583210 TTTCTTATGAAATAACTGTTTGG + Intronic
990229457 5:53696024-53696046 TTCCTTATTAATTTTCTGTTTGG - Intergenic
992261201 5:74972041-74972063 GTCCTTATGAAAGGGCTGGAGGG + Intergenic
992565144 5:77988638-77988660 GTTCTCATGAAAGGTCTGTACGG - Intergenic
994491568 5:100452030-100452052 TTCTTTGAGAAATGTCTGTTCGG - Intergenic
996784746 5:127226734-127226756 TTTCTTCTGACAGTTCTGTTAGG + Intergenic
998640416 5:144004064-144004086 TTCCTTATTAAGGGTGAGTTTGG + Intergenic
999445688 5:151637121-151637143 ATCCTAATGAAAGTTATGTTGGG + Intergenic
1000058367 5:157630013-157630035 TTCCTTATGACAGACCTTTTAGG - Intronic
1202776961 5_GL000208v1_random:89180-89202 TTCCTTTTGATAGGGCAGTTTGG - Intergenic
1202777110 5_GL000208v1_random:91394-91416 TTCCTTTTGATAGGGCAGTTTGG - Intergenic
1003060985 6:2862245-2862267 TTCCTTATAAAAGGACAATTTGG + Intergenic
1004073874 6:12327646-12327668 TTCCCTATGAATGATCTGTGGGG - Intergenic
1004868844 6:19882556-19882578 TGACTTATGATAGGTCTATTGGG + Intergenic
1005576831 6:27197785-27197807 TACCTTATGAAAGATCTTCTTGG + Intergenic
1008917793 6:56808590-56808612 TTCTTTATTAAAGGAATGTTGGG - Intronic
1009298915 6:61990126-61990148 TTACTTATGTGAGGTTTGTTTGG - Intronic
1010063657 6:71654760-71654782 TTCCCTCTGAAAGGCCTGTGGGG - Intergenic
1011010928 6:82703383-82703405 TTCTTTGTGAAAGTTTTGTTTGG - Intergenic
1011703891 6:89982134-89982156 TTCCTTAAGAAATATCTTTTTGG - Intronic
1011787432 6:90862590-90862612 TTCCTTCTAAAAGGTCGTTTCGG + Intergenic
1012197650 6:96364006-96364028 TTACTTATTATTGGTCTGTTTGG - Intergenic
1013669143 6:112379462-112379484 TTCTTTATTAGAGCTCTGTTTGG + Intergenic
1013850306 6:114505463-114505485 TTCCTTATGAAACGGTTGCTTGG + Intergenic
1014562853 6:122912684-122912706 TTCCTTATTAATTTTCTGTTTGG + Intergenic
1014599527 6:123392603-123392625 TTCTTTAGGAAAGTTCTGATAGG - Intronic
1014641901 6:123922385-123922407 TTACATATGAAAATTCTGTTGGG + Intronic
1015516637 6:134088741-134088763 TGCCTGCTGAAAGATCTGTTTGG + Intergenic
1015864958 6:137718615-137718637 TTCCTGATAAAAGGTGTGTTAGG - Intergenic
1016746401 6:147585109-147585131 TTACTTATGAGAGGTGTGTCGGG + Intronic
1017932111 6:158965308-158965330 TTCCGTAAAAAAAGTCTGTTGGG + Intergenic
1019000905 6:168750614-168750636 TTCTTTGTCAAAGGTCAGTTGGG + Intergenic
1020129144 7:5549667-5549689 TTCCTGAGGAAGGGTCTTTTGGG + Intronic
1020150604 7:5679150-5679172 ATCCTCCTGAAAAGTCTGTTAGG - Intronic
1020363304 7:7353101-7353123 TTACCTATGAATGATCTGTTGGG - Intergenic
1020395336 7:7709624-7709646 TTCCCTAACAAGGGTCTGTTTGG + Intronic
1020840161 7:13207110-13207132 TTACTTATTATTGGTCTGTTTGG + Intergenic
1020971644 7:14950575-14950597 TGCCTTATTATAGGTCTATTTGG - Intronic
1021039581 7:15845331-15845353 TTCCTGCTGAAAGGTCTTTTAGG - Intergenic
1021997769 7:26197194-26197216 TCTCTTATTAAAGGTGTGTTGGG - Intronic
1022288853 7:28981331-28981353 TTCCTTAGGAAAAGGCTGATTGG - Intergenic
1022488819 7:30800983-30801005 CTGCTTAAGAAAGGTCTGGTAGG - Intronic
1024667916 7:51564495-51564517 TGATTTATGAAAGGTCTGTGAGG + Intergenic
1024956815 7:54930460-54930482 TTGCTTGTTAATGGTCTGTTCGG - Intergenic
1026664911 7:72333948-72333970 TTCCTTAGGAAAAGTATTTTGGG - Intronic
1027397271 7:77768778-77768800 TTCCTTTTGAAAGGTGACTTTGG - Exonic
1027455334 7:78384212-78384234 TACATTATGAAAGCTATGTTAGG - Intronic
1028209494 7:88055759-88055781 AGCGTTATGAAAGGTGTGTTAGG - Intronic
1031170136 7:118282991-118283013 GTCCCTATTAAAGCTCTGTTAGG - Intergenic
1031853486 7:126894138-126894160 TTCCTTTTTAAAAGTTTGTTTGG + Intronic
1034587690 7:152110080-152110102 AACATTATGAAATGTCTGTTGGG + Intronic
1035429348 7:158806311-158806333 TTTGTTATGAAAGGTATGCTGGG - Intronic
1038999940 8:32968626-32968648 TTCCTTCTGATAGGCCAGTTAGG - Intergenic
1039445319 8:37626438-37626460 TTGCTTATGAAATCTTTGTTGGG - Intergenic
1039784217 8:40818388-40818410 TTCCATATGGAAGATCTTTTTGG - Intronic
1043647996 8:82547435-82547457 TTCTTTCTAAAAGATCTGTTAGG + Intergenic
1045748311 8:105451371-105451393 TTACTGATGAAAGCTCTTTTGGG + Intronic
1048383026 8:133884903-133884925 TTCCTTATGATTGGACTTTTTGG - Intergenic
1050946362 9:11525189-11525211 TTCTTTATTGAATGTCTGTTTGG - Intergenic
1052155319 9:25180583-25180605 TGCCTTATTAATGTTCTGTTTGG - Intergenic
1053448180 9:38169384-38169406 TTACTTATGAATGATCTGTGGGG - Intergenic
1054847364 9:69810979-69811001 TTCCTCAAGAAAGGTCAGTAGGG + Intergenic
1055981409 9:82006141-82006163 TTGTTTATGAAGGGTCTGTGAGG + Intergenic
1057692657 9:97299745-97299767 TTCCTTATGAATCTTCTGTCTGG - Intergenic
1058563467 9:106254953-106254975 TTCCTTCTGAAATCTTTGTTAGG - Intergenic
1059281664 9:113139334-113139356 TGTTTTATGAAAAGTCTGTTTGG - Intergenic
1062141257 9:134960322-134960344 TTCCCTCTGAAAGGTCTGGCAGG - Intergenic
1186085243 X:5982115-5982137 TTCCTTGGGAAATGTATGTTTGG - Intronic
1186197670 X:7125982-7126004 TTCCCTATCAATGGCCTGTTAGG + Intronic
1186730303 X:12402730-12402752 TGCCTTATGAAAGGGCTGGAGGG + Intronic
1188787698 X:34368736-34368758 TTGGCTATGAAAGGTCTTTTTGG - Intergenic
1188898558 X:35699420-35699442 TTCCTTATGTCAGGTGTATTAGG - Intergenic
1189578532 X:42381440-42381462 TTCCTTCTGAAAGGGCTTCTGGG + Intergenic
1189850475 X:45171882-45171904 TTGCTTATTAAAGATCTCTTAGG - Intronic
1189870355 X:45375446-45375468 TTACTTATTATTGGTCTGTTTGG - Intergenic
1191272142 X:58487881-58487903 TTCCTTTTGATAGGGCAGTTTGG + Intergenic
1191758589 X:64623060-64623082 TTCCTTCTCAAATCTCTGTTTGG + Intergenic
1192051245 X:67725775-67725797 TTCTTTCGGAAAGGTCTGGTTGG + Exonic
1192279401 X:69668506-69668528 TTCCTTATGAATTTTCTGTCTGG + Intronic
1192575665 X:72241306-72241328 TGCCTTATGAAAGGGCTGGAGGG + Intronic
1192912986 X:75624747-75624769 TTCCATATGCAAGGTCTCTGGGG + Intergenic
1193203807 X:78724263-78724285 TTATTTATGAATGGTCTATTGGG - Intergenic
1193628925 X:83856753-83856775 TTCCTTATGAATTTTATGTTTGG + Intergenic
1194342772 X:92725578-92725600 TTCCTTATTAAAGTTCTGTCTGG - Intergenic
1194564445 X:95467198-95467220 TTCCTTTCTAAAGTTCTGTTTGG + Intergenic
1197086105 X:122477725-122477747 TTCCTTCACAAAGCTCTGTTGGG - Intergenic
1198386267 X:136132247-136132269 TTCCTCAGGAAAGGGCTGTCGGG - Intergenic
1199920758 X:152400633-152400655 TTCCATATGCAAAGTCTCTTTGG - Intronic
1200358218 X:155574279-155574301 TTGCTTATGAAAGGTCAGAGTGG + Intronic
1200651132 Y:5842243-5842265 TTCCTTATTAAAGTTCTGTCTGG - Intergenic
1201628468 Y:16041662-16041684 TTCCTTTTGAAAGGAATGTTTGG - Intergenic