ID: 929298160

View in Genome Browser
Species Human (GRCh38)
Location 2:40271498-40271520
Sequence GTGAAAAATAGGTTCAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 232}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929298160 Original CRISPR GTGAAAAATAGGTTCAGTGA GGG (reversed) Intronic
902244823 1:15113931-15113953 GAGAAAAATGGGCTCAGAGAGGG + Intronic
905397650 1:37677346-37677368 GGGGAAAAGAGGTGCAGTGAGGG + Intergenic
905503489 1:38457803-38457825 TTGAGAAATAGGTTTAGGGATGG - Intergenic
906334988 1:44921678-44921700 GTCAAAAATGAGTTCACTGAAGG + Intronic
906474641 1:46160759-46160781 GACAAAAATTGGTTTAGTGATGG - Intronic
908164037 1:61439800-61439822 GTGAAAAATAGACTTAGTGGAGG + Intronic
910345597 1:86232758-86232780 GAAAAAAATAGGTTAAGAGAAGG - Intergenic
910508048 1:87972534-87972556 TGTAAAAATATGTTCAGTGAAGG + Intergenic
911007289 1:93240493-93240515 ATGAGAAATAGGTTCAGAAAAGG + Intronic
912254159 1:108042058-108042080 GTCAAATATAGGGTGAGTGATGG + Intergenic
915381773 1:155448136-155448158 GTCAAAAATAAGTTCACTGTAGG + Intronic
915431331 1:155869147-155869169 GTGAAAAATAAATTCACTGGAGG - Intronic
915504205 1:156342537-156342559 GTGAAAAGTAGGTTGTATGAAGG - Intronic
917002943 1:170380402-170380424 GTGAAAAATGAGTTCACTGTAGG + Intergenic
917112468 1:171562974-171562996 GTGAAAGATAAGTTCAAAGAAGG + Intronic
917438288 1:175043316-175043338 GTAAAAAATAAGTTCACTGTGGG + Intergenic
919325622 1:196102746-196102768 GTCAAAAATGAGTTCACTGAAGG - Intergenic
920599795 1:207312528-207312550 GTGATAAATTGGGTCAGGGATGG - Intergenic
924248187 1:242105556-242105578 GAGATAAATAGGCTCAGGGAAGG + Intronic
1063157379 10:3392216-3392238 GTGACAAATAGTTTCAGCTAAGG + Intergenic
1066691756 10:38035618-38035640 GTAAAAAATAGTATCAATGAAGG - Intronic
1068234522 10:54216132-54216154 GCTAAAAATAGGGCCAGTGAGGG + Intronic
1070775963 10:79109967-79109989 ATGAGAAAAAGGTTCAGTGAAGG + Intronic
1071204297 10:83255468-83255490 GTGGCAAATAGGTTAAGGGAGGG + Intergenic
1071935060 10:90520545-90520567 GTCAAAAATAAGTTCACTGTAGG + Intergenic
1074893751 10:117757116-117757138 TTGGAAAATTGGTTCAGTGAAGG + Intergenic
1077956288 11:7023041-7023063 GTGATTAATATGTTCAGTAATGG + Intronic
1078724499 11:13917562-13917584 GTAAAACATGGATTCAGTGAAGG - Intergenic
1078774975 11:14385507-14385529 ATGAAAAATAGGGTGAATGATGG + Intergenic
1079961075 11:26924143-26924165 GTCAAAAATAAGTTCACTGTAGG + Intergenic
1080274448 11:30487824-30487846 GGGGAAAATAGGATCATTGAGGG - Intronic
1080979691 11:37386395-37386417 GTGCAAAATGGGTACATTGAGGG - Intergenic
1081155837 11:39689150-39689172 GACAAAAATAGGTTCAGGGATGG - Intergenic
1081643718 11:44775779-44775801 ATGAAAAATAAATTCATTGATGG - Intronic
1087635729 11:100698956-100698978 CTGAGAAACAGGTACAGTGATGG - Intronic
1088118543 11:106340423-106340445 GGGCAAAGTAGGTGCAGTGACGG + Intergenic
1088143517 11:106647951-106647973 GTGATAAATACGTTCAGACATGG - Intergenic
1088689365 11:112311932-112311954 GTGAAAATTAGGTTTACTTATGG - Intergenic
1089095233 11:115914712-115914734 GTAACAAATAGATTCAGTAAAGG + Intergenic
1089893269 11:121902337-121902359 GTGAAAAATATTTTAGGTGATGG + Intergenic
1091789016 12:3260673-3260695 GGGCAAAATGTGTTCAGTGAGGG + Intronic
1092499159 12:9028760-9028782 GTGAAAAATATGTTTGTTGATGG - Intergenic
1093424833 12:19016793-19016815 TAGAAAAACAAGTTCAGTGACGG + Intergenic
1093959565 12:25257300-25257322 GTGAAAGAGAGATTCACTGAAGG - Intergenic
1094299677 12:28948693-28948715 GTGAAACAGATGTTCATTGAAGG - Intergenic
1095566551 12:43631077-43631099 CAGAAAAATAGCTACAGTGAGGG + Intergenic
1099701868 12:86094061-86094083 GTGTAAAATATGTTCAATGAGGG + Intronic
1100064191 12:90621373-90621395 TTGAAAAGTGGGTTCAGAGAAGG - Intergenic
1101200372 12:102429420-102429442 CTAAAAAACAGGCTCAGTGAAGG - Intronic
1106546997 13:30739329-30739351 GAACAAAATAGGTACAGTGAAGG - Intronic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1109111559 13:58327130-58327152 ATAAAAAATAGAGTCAGTGATGG + Intergenic
1110669495 13:78160346-78160368 ATTAAAAATAGGTTAAGTGAGGG - Intergenic
1111072855 13:83191468-83191490 GTAAAAAATAAGTTTAGGGAAGG + Intergenic
1111210111 13:85067087-85067109 GAGAAAAATAGTTACAGGGAAGG - Intergenic
1113988048 13:114335006-114335028 GTATAAAATAGATTCATTGAAGG + Intergenic
1115322511 14:32098934-32098956 GTGAAGAATGGGTTGAGTGAGGG + Intronic
1117383547 14:55189487-55189509 GGTGAAAATAGGTTAAGTGAAGG + Intronic
1119728318 14:76935651-76935673 GTGAAGAAGAGGGTCTGTGATGG + Intergenic
1120173348 14:81268765-81268787 GTCAAAAATAGCTTCACAGAAGG - Intronic
1120439322 14:84515406-84515428 GTGAAAAATGAGTTCAATGTAGG + Intergenic
1120524907 14:85566730-85566752 CTGAAAAATAGTCTCAGTGTTGG + Intronic
1120604733 14:86560353-86560375 GTGGAAAGTAGGTTCTATGAGGG - Intergenic
1121257939 14:92544886-92544908 GAGAAAAATAGGATCAGGGAGGG - Intronic
1122257737 14:100491322-100491344 GTGAACAAGAGGATCTGTGAGGG - Intronic
1122562728 14:102628353-102628375 GTGAAGAAAAGGTTCTGTAATGG - Intronic
1128509522 15:68304794-68304816 GTGAGAGTTAGGGTCAGTGATGG - Intronic
1128528442 15:68428334-68428356 TGGAAAAAGAGGTTCAGAGAGGG + Intronic
1129601158 15:76999250-76999272 GTAAAAAATGGGTTCAGGAAGGG - Intronic
1131027670 15:89158466-89158488 GAGAAGAATAGGTTAAGTGCAGG + Intronic
1131790205 15:95956358-95956380 GTGAGGAATAGTGTCAGTGAGGG - Intergenic
1132617197 16:847536-847558 GAGAAAAAGAGGCTCAGGGAGGG + Intergenic
1133113994 16:3565584-3565606 GTGAAAGAAAGGGTCAGTGGGGG + Intronic
1133616450 16:7481103-7481125 GAAAAAAATAGGCTCAGAGATGG - Intronic
1134796214 16:17039389-17039411 ATGAAAAGTAAGCTCAGTGAAGG + Intergenic
1137589933 16:49687237-49687259 GTGAAAAATGTGTTGAGAGAGGG - Intronic
1137782836 16:51112463-51112485 GTGAAAAATATGTTAAGAAATGG + Intergenic
1138708198 16:58939347-58939369 GTGAAAAAGGGGTTGAGAGAAGG + Intergenic
1140198205 16:72873138-72873160 GTGAAAAATACGCCCATTGAAGG - Intronic
1140900265 16:79360463-79360485 GAGAAAAACAGGCTCAGAGACGG - Intergenic
1140958646 16:79891544-79891566 CTGAATGTTAGGTTCAGTGAAGG - Intergenic
1142969592 17:3602294-3602316 GTGCAAGCTAGGTTCAGAGAGGG - Intergenic
1143074774 17:4332045-4332067 GTGAACAATGCATTCAGTGAAGG - Intronic
1146139700 17:30354989-30355011 GAAAGAAACAGGTTCAGTGAAGG + Intergenic
1146798013 17:35796087-35796109 GAGAAAAGTGGGTTCAGAGAGGG - Intronic
1148519809 17:48261981-48262003 GTAAAAGAAAGTTTCAGTGAGGG + Intronic
1152005593 17:77678429-77678451 ATAAAAAATGGGTTGAGTGAAGG - Intergenic
1156140454 18:34102409-34102431 ATGAAAAAGAGGTTAAGTAAAGG - Intronic
1157191354 18:45584846-45584868 GTGAAAAAAATGTTAAGTGCTGG + Intronic
1157538450 18:48479751-48479773 GTGAAATAGAGGTTTTGTGATGG + Intergenic
1158816100 18:61098989-61099011 GTGAATTATAGGTACAGGGAAGG + Intergenic
1159867357 18:73721863-73721885 GTGAAACAAAGATTCAGTGAAGG + Intergenic
1161089927 19:2354631-2354653 GTACAAAATGGCTTCAGTGAAGG - Intronic
1163274933 19:16277535-16277557 GTGAAAAATCTGTTCAATGCTGG + Intergenic
1164304185 19:23988984-23989006 GTGTCAAAAAGGTTCTGTGAAGG + Intergenic
1164741556 19:30579880-30579902 GGGAAGAATGGGTTCAGTGGTGG - Intronic
925810461 2:7695134-7695156 GTGAAAATTTGGTTCATGGAGGG + Intergenic
926086376 2:10022778-10022800 GTGAAAAATTGGCTCAGACAAGG - Intergenic
926588968 2:14719544-14719566 GTGACACATAGGTCAAGTGATGG + Intergenic
929298160 2:40271498-40271520 GTGAAAAATAGGTTCAGTGAGGG - Intronic
929891866 2:45924998-45925020 GTTCTTAATAGGTTCAGTGAGGG + Intronic
930463512 2:51714333-51714355 GTGAAAAATGAGTTCACTGTAGG + Intergenic
930597062 2:53401899-53401921 GTGAAAAGTAAGTTCGTTGAAGG - Intergenic
935094909 2:99934970-99934992 GTCAAATGTAGGTTCAGAGAAGG - Intronic
935428219 2:102943625-102943647 GTGAAAAATGGCATCAGTGTTGG + Intergenic
935830292 2:106995112-106995134 ATAAAAAATAGAATCAGTGAAGG + Intergenic
936906586 2:117542414-117542436 GTGTAAAATATGTACAGGGAAGG + Intergenic
940314541 2:152313916-152313938 GTCAAAAATAAGTTCACTGTAGG + Intergenic
941520267 2:166533692-166533714 GTGAGAAATAAGTTCAGTTAAGG - Intergenic
941553382 2:166944068-166944090 GTGAATAATTGGTACAATGAAGG + Intronic
943499873 2:188674417-188674439 CTGAAAAATAGAGTCAATGAAGG - Intergenic
946367248 2:219256077-219256099 AGGAAAAAGAGGTTCAGGGAGGG - Intronic
946477937 2:220026987-220027009 GTGGAAAATAGAATCAGTGGGGG + Intergenic
946806699 2:223477631-223477653 GTTAAATATATGTTCAGAGAAGG + Intergenic
947399868 2:229720766-229720788 GTGACAGATTGGTTCAGAGATGG + Intergenic
1168835265 20:873404-873426 TGGAAAGACAGGTTCAGTGAGGG - Intronic
1170531702 20:17299709-17299731 GTGAAAAATTGGATTAGCGAAGG - Intronic
1170619496 20:17982874-17982896 ATGATAAATAGGTGAAGTGATGG - Intronic
1170957980 20:20999065-20999087 GTGAAAAATATGTTCTTGGAGGG + Intergenic
1171018394 20:21562212-21562234 GTGAGTAATGGGTTCAGTGATGG - Intergenic
1175770128 20:61618271-61618293 GTGAGAAAGGGGTTCACTGAGGG + Intronic
1177257106 21:18678587-18678609 GTAAAAAATAGGGTAAGTGTAGG + Intergenic
1177355518 21:20001344-20001366 CTTAAAAATAGGTTCAAAGATGG - Intergenic
1177923214 21:27180676-27180698 ATGAAAAATAGTTTGAGTAAGGG + Intergenic
1178252788 21:31020656-31020678 GTGACAAATGGGGACAGTGAAGG + Intergenic
1178502426 21:33136773-33136795 GATAAAATTAGGCTCAGTGAAGG - Intergenic
1178810892 21:35880354-35880376 ATGATAAATAGGTGAAGTGATGG - Intronic
1181747661 22:24967056-24967078 GTAAAAAAAAGGTCCAGAGAGGG - Intronic
1183058970 22:35323738-35323760 GAGGAAAACAGGATCAGTGAGGG - Intronic
1184364723 22:44043116-44043138 CTGGAAAACAGGCTCAGTGAGGG + Intronic
952066020 3:29571564-29571586 GTGAAAAATGAGTTCACTGTAGG + Intronic
953469835 3:43157171-43157193 GAAAGAAAAAGGTTCAGTGATGG - Intergenic
953808741 3:46094051-46094073 ATGAAAGAGAGGTTCAGTTAAGG + Intergenic
955119767 3:56046250-56046272 TTGAAAAATAAGTTCAGTACCGG - Intronic
955284460 3:57625505-57625527 GTGAAAAAGAGGTTTTGTGAAGG - Exonic
957189201 3:76984452-76984474 GAGAACAATAGGCTCAGTGAAGG - Intronic
957889801 3:86341870-86341892 GTCAAAAATAAGTTCATTGTAGG + Intergenic
959118627 3:102207033-102207055 GTTAAAACTAGGTGCTGTGAGGG + Intronic
960251501 3:115460750-115460772 CTGCAAAGTAGGTTCTGTGATGG + Intergenic
960880870 3:122343429-122343451 TTGAAAACTATGTTAAGTGAAGG - Intergenic
961195964 3:125001733-125001755 GCCAAAAATAGGCTCTGTGAGGG + Intronic
963118335 3:141753178-141753200 GAGGAAAATAGGTTCAGAGAAGG - Intergenic
963554016 3:146762589-146762611 ATTAAAAATAAGTACAGTGATGG - Intergenic
964685280 3:159388618-159388640 GTGAAAAAGAGGAACATTGAGGG + Intronic
964936219 3:162091516-162091538 GTGAAAAATGAGTTCACTGTAGG + Intergenic
965350771 3:167609241-167609263 GTGAAAACCAGGTACAATGAGGG - Intronic
965682249 3:171263655-171263677 GTGAATAGTAAGTTCAGTGAAGG + Intronic
965682318 3:171264229-171264251 GTGAATAGTAAGTTCAGTGAGGG - Intronic
965839439 3:172886922-172886944 GTGATAAATATTTGCAGTGAGGG - Intergenic
966258890 3:177951405-177951427 CTGAAAAATAGGTTCAGCAATGG - Intergenic
966318961 3:178679602-178679624 GTGAAGATTAGGTTCAAGGAAGG + Intronic
967728591 3:192885069-192885091 GACAAAAATTGGTTCTGTGAGGG + Intronic
970516284 4:16834059-16834081 GTGAAAAATATATTAAGTTAAGG - Intronic
970683197 4:18535253-18535275 GTGGAAAATAGATTGAGTGATGG - Intergenic
970693658 4:18648820-18648842 GTGAAAAATGAGTTCACTGCAGG - Intergenic
970737904 4:19196012-19196034 GAGAGAAAAAGGGTCAGTGAAGG + Intergenic
970809083 4:20070427-20070449 GTGAAAAATTGGTATGGTGATGG + Intergenic
970909894 4:21262626-21262648 GTAAAAAATAGGTCCAGAAAGGG - Intronic
972335810 4:38106548-38106570 GTGAGAAATAGGTTCAGGGTGGG + Intronic
972997160 4:44895091-44895113 TTGAATAATCAGTTCAGTGATGG - Intergenic
973692185 4:53447417-53447439 GAGAAAGAAAAGTTCAGTGAAGG - Intronic
973829136 4:54740934-54740956 TTGAAAAATAGATACAGAGAAGG + Intergenic
974918869 4:68211716-68211738 GTGAAAAACAGGGATAGTGAAGG + Intergenic
975170465 4:71226786-71226808 GTTAGAAATAGGCACAGTGAGGG - Intronic
976327627 4:83790534-83790556 GTGGAAAATAGGCACAGTGCTGG - Intergenic
976635115 4:87279584-87279606 GGGAAAAATAGGTTAGGTGGTGG + Intergenic
978262857 4:106782915-106782937 GTCAAAAATGGGTTCACTGTAGG - Intergenic
980014687 4:127635652-127635674 TTTAAAAATAGCTTCATTGAAGG + Intronic
980491601 4:133534293-133534315 TTCAAAAATAGAGTCAGTGAAGG + Intergenic
981356002 4:143789725-143789747 AGGAAAAATAGGATAAGTGAAGG - Intergenic
987282971 5:16428809-16428831 CTGAAAAATAGGTTTGGTGAGGG + Intergenic
988784819 5:34556776-34556798 TTGAAAAATAGTTTGAGTGATGG - Intergenic
988855289 5:35222387-35222409 GTGAACAAGAGCTTCAGAGAAGG + Intronic
989111510 5:37911104-37911126 GTGAAAAATGAGTTCACTGTAGG - Intergenic
990439195 5:55827579-55827601 GTGAGAAATAAATTCAGGGAAGG - Intergenic
990655643 5:57951642-57951664 GTTATCAATAGGCTCAGTGAAGG + Intergenic
991308236 5:65204855-65204877 GTGAAAGATAGTTTCTGTGTGGG - Intronic
992548408 5:77838238-77838260 GAGAAAAATATGTTCATTGTTGG + Intronic
992865204 5:80950981-80951003 AAGAAAAACAGGTTCAGAGAAGG - Intergenic
993948780 5:94148018-94148040 GTCAAAAATAAGTTCACTGTAGG - Intergenic
998769947 5:145531517-145531539 GTGAATCATACTTTCAGTGAAGG - Intronic
1000455252 5:161440819-161440841 GTCAAAAATGGGTTCACTGTAGG - Intronic
1008215644 6:48784846-48784868 GTCAAAAATGAGTTCAGTGTAGG - Intergenic
1008842221 6:55916524-55916546 CTGAAAAATAGTTTTCGTGATGG + Intergenic
1009511782 6:64560729-64560751 TATAAAAATAGGTGCAGTGAGGG + Intronic
1010280712 6:74019702-74019724 GTCAAAAATAAGTTCACTGTAGG - Intergenic
1010377488 6:75188466-75188488 TTGAAAACATGGTTCAGTGAAGG + Exonic
1012679332 6:102159315-102159337 GTCAAAAATAGTTTCACTGTAGG - Intergenic
1012734353 6:102920072-102920094 TTGAGAAATAGATCCAGTGAGGG + Intergenic
1013006516 6:106079291-106079313 GTTAAAACAAGGATCAGTGAGGG + Intergenic
1013428168 6:110033583-110033605 GTGTAAAAATGTTTCAGTGATGG - Intergenic
1014840929 6:126219150-126219172 GTTAAAACTAGGTCCTGTGATGG + Intergenic
1015650150 6:135448000-135448022 TTGAAAAATAGTTTCTGTAAAGG - Intronic
1015675979 6:135749350-135749372 GTCAAAATTGGGTTCACTGAAGG + Intergenic
1017031712 6:150229804-150229826 ATGAAAAATAGGATCAGTTCTGG + Intronic
1017365909 6:153637203-153637225 GTCAAAAATAAGTTCACTGTAGG + Intergenic
1017425382 6:154315353-154315375 GGGAAAAACAGGGTCCGTGAAGG + Intronic
1017529933 6:155279494-155279516 GTGAATAAGAGGTGCAGGGAGGG + Intronic
1017568880 6:155720378-155720400 GTGATAAATATTTACAGTGATGG + Intergenic
1020523534 7:9227109-9227131 TTGGAAAATAGGATCAGTGAAGG - Intergenic
1021715206 7:23455427-23455449 GTGAGAAATACATTCAGAGAGGG - Intronic
1022974441 7:35544548-35544570 GTGAAAACCAGATTCAGGGATGG + Intergenic
1023619524 7:42055562-42055584 ATGAAAAAGTGATTCAGTGAGGG - Intronic
1024392273 7:48828611-48828633 GTGAAGGATAGATTCAGTGGTGG + Intergenic
1025674273 7:63631744-63631766 GTGAGAAATAGATGGAGTGAAGG - Intergenic
1026137358 7:67675006-67675028 GGGAAGAGTAGGTGCAGTGAGGG - Intergenic
1026366513 7:69653978-69654000 GGGAAAAATTGGATCAGTTAGGG + Intronic
1028667116 7:93359132-93359154 GTGAAAAGTAATTTCATTGAGGG + Intronic
1029874459 7:103734559-103734581 GTGATAAATTGGTTCAGAGAAGG - Intronic
1030017164 7:105234800-105234822 GAAAAAAAAAGGTTCAGTGTGGG + Intronic
1030956998 7:115865417-115865439 TTAAAAATGAGGTTCAGTGAAGG + Intergenic
1031324542 7:120377322-120377344 GTGAAAAATACATCCAGAGAAGG + Intronic
1034708149 7:153165367-153165389 GTCAAAAATCAGTTCATTGAAGG + Intergenic
1038146186 8:24898310-24898332 AGGAAAAATGGCTTCAGTGAGGG + Intergenic
1041601940 8:59729361-59729383 ATGAAAAATCTGTTCAGTGGTGG - Intergenic
1042047681 8:64672406-64672428 GGGAATAATAGGGTCAGAGAGGG - Intronic
1042540302 8:69901386-69901408 GTGCAAAATAAGTGCATTGAAGG + Intergenic
1046940271 8:119924330-119924352 GGGAAAGATAGGTGCAATGAAGG - Intronic
1050363910 9:4856411-4856433 TTGAATAACGGGTTCAGTGATGG + Intronic
1051038920 9:12782528-12782550 GTGAAAAATGAGTTCACTGTAGG + Intronic
1053541067 9:38974315-38974337 GTGAAAAATAAGCTCAAGGATGG - Intergenic
1053805488 9:41797360-41797382 GTGAAAAATAAGCTCAAGGATGG - Intergenic
1054625073 9:67389592-67389614 GTGAAAAATAAGCTCAAGGATGG + Intergenic
1055342122 9:75294981-75295003 GTGAAAAATGAGTTCACTGTAGG + Intergenic
1058318717 9:103602376-103602398 GGGAAAAATGGGTTAAGTAATGG - Intergenic
1060018757 9:120110308-120110330 GAGAAAAACAGGTTTAGAGAAGG + Intergenic
1060704830 9:125788945-125788967 GTGAATAATAAATTCAGTGTGGG - Intronic
1186839210 X:13468378-13468400 GTGGAAACAAGATTCAGTGAAGG - Intergenic
1187095275 X:16141458-16141480 GTGAAAAATGGCACCAGTGAAGG - Intronic
1188027662 X:25227373-25227395 GTCAAAAATAAGTTCACTGTAGG - Intergenic
1188906348 X:35796835-35796857 GAGACAAATAGGTTCAGTATTGG - Intergenic
1188957563 X:36451563-36451585 GTCAAAAATGAGTTCACTGAAGG - Intergenic
1189141247 X:38608515-38608537 GTCTAAAATAAGTTCAGTAATGG - Intronic
1190397497 X:49999617-49999639 GGGAAAAATAAGTTCAGAAATGG + Intronic
1190436019 X:50426321-50426343 CTGAAAAATAGGTTCTTTAAGGG - Intronic
1190946238 X:55096570-55096592 TTGTATAATAGATTCAGTGATGG + Intronic
1191926976 X:66323582-66323604 GTCAAAAATGTGTTCAGTGTAGG - Intergenic
1192134919 X:68588309-68588331 GTCAAAAGTTGTTTCAGTGAGGG - Intergenic
1193024428 X:76830037-76830059 ATGCAAAACAGGTTCAGAGATGG - Intergenic
1193985150 X:88231938-88231960 GGCAAAAATAGGTTCACTGTAGG - Intergenic
1194306243 X:92253232-92253254 GTCAAAAATGAGTTCAGTGTAGG + Intronic
1194327466 X:92537720-92537742 GTCAAAAATAAGTTCACTGTAGG - Intronic
1194478913 X:94395422-94395444 GTTAAAAATGAGTTCAGTGTAGG + Intergenic
1194567730 X:95513914-95513936 GTGAAAAATATATTCAATCATGG + Intergenic
1195124584 X:101794259-101794281 ATGATAAATAGGTGAAGTGATGG - Intergenic
1196199371 X:112868096-112868118 ATGGAAAATAGGTTAAGTGGGGG + Intergenic
1196205861 X:112938558-112938580 GTCAAAAATGAGTTCACTGAAGG - Intergenic
1196471068 X:116027952-116027974 GTCAAAAATAAGTTCATTGTAGG + Intergenic
1196516438 X:116617953-116617975 GAGAGAAGGAGGTTCAGTGATGG + Intergenic
1197299936 X:124765922-124765944 GTTAAAAATAATTTCCGTGACGG - Intronic
1197476535 X:126931437-126931459 GTCAAAAATAGATTCACTGTAGG + Intergenic
1199277883 X:145967886-145967908 GTTAAAAATGAGTTCACTGAGGG - Intergenic
1200008534 X:153104199-153104221 GTGGAAAATAGGATTAGTGTGGG + Intergenic
1200636182 Y:5656939-5656961 GTCAAAAATAAGTTCACTGTAGG - Intronic
1201617259 Y:15914332-15914354 ATGAAAAATAGATTAAGAGATGG + Intergenic