ID: 929299685

View in Genome Browser
Species Human (GRCh38)
Location 2:40288732-40288754
Sequence CTAGTTTACCAGCACACCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 6, 3: 29, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929299684_929299685 -1 Left 929299684 2:40288710-40288732 CCTTGGGGATGGATGTTTGGAGC 0: 1
1: 0
2: 2
3: 13
4: 142
Right 929299685 2:40288732-40288754 CTAGTTTACCAGCACACCAGTGG 0: 1
1: 0
2: 6
3: 29
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929299685 Original CRISPR CTAGTTTACCAGCACACCAG TGG Intronic
902601846 1:17545262-17545284 CCTGTTTACCAGCACACCACTGG + Intronic
907777439 1:57531717-57531739 AAATTTTACCAGCACACCATTGG - Intronic
910544035 1:88394125-88394147 CTAGTTTACATTCCCACCAGTGG - Intergenic
911439193 1:97904132-97904154 CTAGTTTACCATCATATCACTGG + Intronic
911444507 1:97973645-97973667 CCAGCTTACCAGAACACCACTGG - Intergenic
912963229 1:114214413-114214435 ACAGTTTACCAGCACCCCACTGG - Intergenic
913296202 1:117323047-117323069 CCAGTTAACCAGCACACCGCTGG + Intergenic
915078847 1:153337453-153337475 CTAGTTTACCAGCACTCCATTGG - Intronic
915240332 1:154516637-154516659 CTGGTTAACGAGCACAGCAGGGG + Intronic
915820783 1:159021701-159021723 CTAGTTTACATTCCCACCAGCGG + Intronic
918108596 1:181435191-181435213 AATGTTTACCAGCACACCACTGG + Intronic
918566209 1:185936117-185936139 CTAGTTCCCAAACACACCAGTGG - Intronic
922241225 1:223756565-223756587 CCAGTTTCCCAGCACACCCCTGG + Intronic
922537139 1:226389802-226389824 CTTGTTAACAAGCACACCAGGGG - Intronic
924658627 1:245995922-245995944 GAAGTTTTCCACCACACCAGTGG + Intronic
1064965205 10:21008678-21008700 CTAGTTTACATTCCCACCAGCGG - Intronic
1069005506 10:63313540-63313562 CTAGTTTACATTCCCACCAGCGG + Intronic
1074935522 10:118175984-118176006 TCAGTTTACCAGCACACCATTGG - Intergenic
1075251041 10:120873859-120873881 CTGGTGTACCATCTCACCAGTGG + Exonic
1075532147 10:123238723-123238745 GCAGTTTACCAGCACACCAGTGG + Intergenic
1075899922 10:126033269-126033291 CCAGTTTGCCAGCATACCATTGG + Intronic
1076276743 10:129205934-129205956 CTATTTTACAAGCAAACCATTGG - Intergenic
1076506871 10:130984162-130984184 CAAGCTCACCAGCACACCATGGG - Intergenic
1078711845 11:13800092-13800114 CTAGTTTACAGTCCCACCAGCGG - Intergenic
1085516463 11:77114774-77114796 GCAGTTTACCAGCACAGCACAGG - Intronic
1086949323 11:92875547-92875569 CTGGTTTACCAGCACACCCCTGG - Intronic
1087020804 11:93601144-93601166 GCAGTTTAGCAGCACACCACAGG + Intergenic
1087311720 11:96551504-96551526 AATGTTTACCAGCACACCACTGG + Intergenic
1089323671 11:117643037-117643059 CTAGGTAACAAGTACACCAGAGG - Intronic
1091143493 11:133256920-133256942 CTGGTCTACCAGCCCACCACTGG - Intronic
1091212992 11:133879702-133879724 CTAGTTTACAATCCCACCAACGG + Intergenic
1092061249 12:5552457-5552479 CTAGTTTACATTCCCACCAGCGG - Intronic
1095493702 12:42762549-42762571 TCATTTTACCAGCACACCACTGG + Intergenic
1095928587 12:47604169-47604191 CTGGTTTACCAGCACACCACTGG - Intergenic
1097814815 12:64060806-64060828 CTATTTTAACAGCAAACCAACGG + Intronic
1097938103 12:65276060-65276082 AATGTTTACCAGCACACCACTGG + Intergenic
1101093545 12:101312860-101312882 AAATTTAACCAGCACACCAGTGG + Intronic
1101473434 12:105020978-105021000 ATATTTTACCAGCACACCCCTGG + Exonic
1101603457 12:106230410-106230432 CAACTTTTCCAGCACACCAGGGG - Intergenic
1102962796 12:117104208-117104230 CTTGTTTACCAGCTCACCACTGG - Intergenic
1105324226 13:19355605-19355627 CTGGCTTACCAGCACACCCCCGG - Intergenic
1105869038 13:24487799-24487821 CTGGCTTACCAGCACACCCCCGG + Intronic
1107571671 13:41666653-41666675 CTAGTTTACTAGCACGCCACCGG + Intronic
1108936362 13:55886017-55886039 CTAATTTTCCAGCACTGCAGTGG - Intergenic
1110368350 13:74712951-74712973 CTTGTCTACCAGCACATCACTGG - Intergenic
1111281159 13:86027109-86027131 CTAGTTTACATTCCCACCAGCGG + Intergenic
1113401757 13:110000772-110000794 CTAATTCAACAGCACACGAGAGG + Intergenic
1114054010 14:18950581-18950603 CTAGTTTACATTCCCACCAGCGG + Intergenic
1114108547 14:19451351-19451373 CTAGTTTACATTCCCACCAGCGG - Intergenic
1114859759 14:26501285-26501307 TTAGTTTACTAGTACATCAGGGG + Intronic
1116222340 14:42104350-42104372 CTAGTTTCCTGGGACACCAGTGG - Intergenic
1116348489 14:43828002-43828024 CTAGTTTACTATCCCACCAACGG + Intergenic
1116923555 14:50608496-50608518 CCAGTTTATCAGCACATCACTGG + Intronic
1123765874 15:23477988-23478010 CTATCTCACCAGCACACCTGTGG - Intergenic
1124175788 15:27422801-27422823 CTAGTGAATCAGCACACCTGGGG - Intronic
1126539721 15:49808474-49808496 CTGGTTTACCAGCACACCACTGG + Intergenic
1127050995 15:55083881-55083903 CAAGTTTACCAGCAGAACAATGG + Intergenic
1130038225 15:80380817-80380839 AAAATTTACCAGCACACCACTGG + Intronic
1130736196 15:86552508-86552530 CTATTTGACCAGCCCCCCAGGGG + Intronic
1130811979 15:87389355-87389377 CCAGGTAACCAGCACACCAATGG - Intergenic
1131992775 15:98106720-98106742 CCAGTTTGCCAGCAAACCACAGG - Intergenic
1132098154 15:99003753-99003775 CCAGTTTGCCAGCAAACCACAGG + Intronic
1133112686 16:3558005-3558027 CCAGTTTACCAGTACACCACTGG - Intronic
1134374810 16:13662040-13662062 CTAGTCAACCAGCACTCCACAGG + Intergenic
1136013235 16:27378408-27378430 TTGGCTTACCAGCACACCACTGG + Intergenic
1137064734 16:35828331-35828353 CTAGTTTACAATCCCACCAATGG + Intergenic
1139028694 16:62852408-62852430 CCAGTTTATTAGCACACCACTGG - Intergenic
1140406922 16:74717377-74717399 CTGGTTTTCCAGCACATCACTGG - Intronic
1140835011 16:78785423-78785445 ATCATTTACCAGCACACCACTGG - Intronic
1144319007 17:14095475-14095497 CTAGTCTACCAGCAACACAGAGG - Intronic
1144669675 17:17125903-17125925 CATGGTTACCACCACACCAGGGG - Intronic
1145011241 17:19369480-19369502 CTACTTTACCAGCACATCACTGG + Intronic
1145788006 17:27606567-27606589 CACATTTACCAGCACACCACTGG - Intronic
1148448174 17:47754027-47754049 CTGGTTTACTACCACACCACTGG + Intergenic
1148984134 17:51606812-51606834 CTGGTCTACCAGCACACCAATGG - Intergenic
1149279492 17:55086863-55086885 CTAGTTTACATTCCCACCAGTGG + Intronic
1150480594 17:65506021-65506043 TTGGTTTACCAGCATACCACTGG - Intergenic
1150812642 17:68368731-68368753 CTACTTTACCTGTAAACCAGAGG - Exonic
1151781719 17:76251099-76251121 CCAGTTTACCAGCATACCCCTGG + Intergenic
1152990498 18:359317-359339 CTAGTTTACCGGCATGCCACTGG + Intronic
1155141093 18:23045020-23045042 AGCATTTACCAGCACACCAGTGG - Intergenic
1159605906 18:70474628-70474650 CCAGTTTACCAGCACAACACTGG - Intergenic
1162206354 19:9059054-9059076 CCATTTTACAAGCACTCCAGGGG + Intergenic
1164848548 19:31458796-31458818 CTTGTTGTCCAGCACAACAGAGG - Intergenic
929299685 2:40288732-40288754 CTAGTTTACCAGCACACCAGTGG + Intronic
930224845 2:48781519-48781541 CTGGTTTACCAGCACAGCACTGG - Intergenic
930384410 2:50675534-50675556 CTAGTTTATCATCACTCCACTGG - Intronic
930564126 2:52998247-52998269 CTACTTTACCACAACGCCAGTGG + Intergenic
931599152 2:63985402-63985424 TTAGTTTTCCAGCAAACTAGAGG - Intronic
937469499 2:122163147-122163169 CTAGTATACCTTCCCACCAGAGG + Intergenic
938552251 2:132393249-132393271 TCAGTTTACCAGCACACCGCTGG + Intergenic
939023822 2:136988524-136988546 CCAGTTTACTCACACACCAGTGG - Intronic
940527619 2:154837495-154837517 CTACTTCACCACCACTCCAGAGG - Intronic
941271884 2:163440352-163440374 GTAGATTAAAAGCACACCAGTGG + Intergenic
942943974 2:181653301-181653323 CTAGTTTACAATCATACCACCGG - Intronic
943407118 2:187503158-187503180 CTAGTCAACCAGGACACCAAAGG - Intronic
944358339 2:198820630-198820652 CCAGTTTACCAGCACACCCCTGG - Intergenic
944466948 2:200011268-200011290 ATGGCTTACCACCACACCAGCGG + Intergenic
944636238 2:201678520-201678542 CTATTTCACCAGCACCCCACTGG - Intronic
946987859 2:225293052-225293074 CTAGTTTAAGATCACACCATGGG - Intergenic
947144592 2:227053108-227053130 CTAGTTTACTAGCCCATCACTGG + Intronic
948842321 2:240658774-240658796 CTAGTTTACATTCCCACCAGCGG - Intergenic
1169215791 20:3794196-3794218 CTAGTTTACAGTCCCACCAGCGG + Intronic
1170392318 20:15889091-15889113 TTAATTTACAAGCACCCCAGTGG - Intronic
1175311573 20:58015371-58015393 CTGGTTCACCAGCACACCCCTGG - Intergenic
1175509278 20:59511646-59511668 CTAGTTTACTTTCCCACCAGCGG + Intergenic
1180472481 22:15672962-15672984 CTAGTTTACATTCCCACCAGCGG + Intergenic
1180628859 22:17213231-17213253 CTAGTTTACACTCCCACCAGTGG - Intronic
1182179717 22:28334449-28334471 CTAGTTTACAATCCCACCAACGG + Intronic
1182741815 22:32573143-32573165 CCAGTTTGCCAGCACACCACTGG + Intronic
1183608707 22:38882943-38882965 CTAATTAACTAGCAGACCAGAGG - Intergenic
949127413 3:463017-463039 CTAGTGTCTCAGCTCACCAGAGG + Intergenic
949211071 3:1502064-1502086 CTAGTTTACATTCCCACCAGCGG - Intergenic
951069534 3:18310422-18310444 CTAGTTTGTCAGCACATAAGGGG + Intronic
952456797 3:33480084-33480106 CTAGTTTACAGTCCCACCAGTGG - Intergenic
957108113 3:75917634-75917656 CTATTTTACAAGGCCACCAGTGG + Intronic
960549080 3:118953500-118953522 CTAGTTTACATTCCCACCAGAGG + Intronic
960558359 3:119054573-119054595 CTAGTTTACATTCCCACCAGCGG - Intronic
960824655 3:121770265-121770287 CTAGTCTACCAGCATGCCAGAGG + Exonic
963749714 3:149164021-149164043 CTAGATTAACAGGACACCTGGGG - Intronic
964174432 3:153808747-153808769 CTTATTTACCAGCACACTACTGG + Intergenic
965836979 3:172863573-172863595 CCAGTTTTCCAGCACACCTTTGG - Intergenic
965850537 3:173017504-173017526 CCAGGTTACCAGCATACCATTGG - Intronic
970577057 4:17437694-17437716 CTTGTTCACCAGCACAGGAGCGG + Intergenic
972800315 4:42468120-42468142 CTAGTTTACATTCCCACCAGCGG - Intronic
974169276 4:58245410-58245432 CCAGTGGACCAGCAGACCAGTGG + Intergenic
975071434 4:70144629-70144651 CTAGTTTACATTCCCACCAGCGG + Intronic
975582215 4:75917381-75917403 CTGGTTTACTAGCAGACCACTGG + Intronic
975687918 4:76936135-76936157 ATAGTACACCACCACACCAGAGG + Intergenic
976792832 4:88898813-88898835 CTAGTTTACGTTCCCACCAGTGG - Intronic
978498178 4:109382380-109382402 AACATTTACCAGCACACCAGTGG + Intergenic
979358768 4:119736634-119736656 AACGTTTACCAGCACACCACTGG - Intergenic
981354230 4:143768695-143768717 TGAGTTTATCAGCACACCACCGG - Intergenic
981887742 4:149697566-149697588 CAAATTTACCAGCACACCATTGG + Intergenic
982075744 4:151735484-151735506 CTAGTTTACATTCCCACCAGCGG - Intronic
982508904 4:156255293-156255315 GTATTTTGCCAACACACCAGTGG + Intergenic
982596433 4:157391093-157391115 CCAATTTACCAGCACACCATTGG - Intergenic
987080921 5:14424615-14424637 ATAGTTTACCACAACTCCAGTGG + Intronic
987181238 5:15370680-15370702 CAACTTTACCAGCCCTCCAGAGG + Intergenic
987413984 5:17643505-17643527 CTAGTTTACATTCCCACCAGTGG + Intergenic
989491409 5:42060115-42060137 CCAGTAGACCAGCATACCAGAGG + Intergenic
992273548 5:75090891-75090913 CTAAGTTACCAATACACCAGTGG + Intronic
992798721 5:80276515-80276537 CTAGTTTACCTGCACACAAGGGG + Intergenic
1003592301 6:7446267-7446289 CTTGTTCTCCAGGACACCAGAGG - Intergenic
1005662433 6:28012402-28012424 CTAGTCTACCAGCATGCCAGAGG - Intergenic
1006162848 6:32048169-32048191 CTACTTTCCCTGCACCCCAGGGG - Intronic
1006784834 6:36659355-36659377 CTGGTTTACCAGCACACTACTGG - Intergenic
1007367990 6:41408003-41408025 CTAGTCTACCAGCTCCCCAGGGG + Intergenic
1010072252 6:71757166-71757188 ATTATTTACCAGCACACCACTGG - Intergenic
1013738581 6:113256984-113257006 CTGGTTTACCAGCATACCACTGG + Intergenic
1015142474 6:129950612-129950634 TTAGTTTACCAGCTCAGTAGAGG + Intergenic
1015622057 6:135141641-135141663 CTGGTTAAACAGCACACCACTGG - Intergenic
1015953839 6:138580464-138580486 CCAGTTTACTAACACACCACTGG - Intronic
1018279047 6:162164805-162164827 CAAGTTTACTAGGACACTAGAGG + Intronic
1026957602 7:74387564-74387586 CTTGTTCACCAGAACACCAGTGG + Intronic
1031760658 7:125709434-125709456 CTAGTTTACATTCCCACCAGCGG + Intergenic
1032471245 7:132180824-132180846 CTTCTTCACCAGCTCACCAGCGG - Intronic
1033554453 7:142476572-142476594 CCAGTTTATCAGCACATCACTGG + Intergenic
1033914594 7:146308371-146308393 CTAGTTTACAATCCCACCAATGG - Intronic
1037922522 8:22817431-22817453 CTGGGTTACCAGCATACCACTGG + Intronic
1040364365 8:46699815-46699837 CTAGTTTACAACCCCACCAACGG + Intergenic
1040413160 8:47175606-47175628 CACATTTACCAGCACACCACTGG + Intergenic
1041313058 8:56536047-56536069 TTATGTTACCAGAACACCAGGGG - Intergenic
1041365745 8:57102219-57102241 CTAGTTTACATTCCCACCAGCGG + Intergenic
1041589940 8:59566578-59566600 CTAGTTTACATTCCCACCAGCGG - Intergenic
1042218205 8:66448496-66448518 CCAGTTTACTAGCACACCACTGG - Intronic
1042463764 8:69102270-69102292 CTAGTTTCTGATCACACCAGTGG - Intergenic
1042738048 8:72010952-72010974 CTAGCTTGCCAGCACACCGTTGG + Intronic
1042956814 8:74259932-74259954 CTACTTCACCAGCATGCCAGTGG - Intronic
1044400386 8:91763995-91764017 CAGGTTTACCAGCACAACATTGG + Intergenic
1047035182 8:120930421-120930443 TTTGTTTACCAGCACACCACTGG + Intergenic
1048640517 8:136353579-136353601 CTAGTGTACCAGCTCACCAGGGG + Intergenic
1049263116 8:141650439-141650461 CCAGTTCACCAGCACACAACTGG - Intergenic
1050266984 9:3901493-3901515 ATACATTACCAGCACACCACTGG + Intronic
1051290625 9:15542063-15542085 CTAGTTTACTAGCATGCCACTGG + Intergenic
1054826332 9:69577445-69577467 CCAGTACACCAGCACACAAGGGG + Intronic
1057387684 9:94618918-94618940 CCAGTTTACCAGCACATCACTGG + Intronic
1059731451 9:117061012-117061034 TCAGTTTACCAGCATACCACTGG + Intronic
1060273963 9:122168212-122168234 CTAAGTTCCCAGCACACAAGAGG + Intronic
1060398385 9:123332534-123332556 GCAGTTTACCAGCACACCACTGG - Intergenic
1060504642 9:124188657-124188679 CTGGTCTACCAGCACTCCACTGG + Intergenic
1061841826 9:133363000-133363022 CTGGTTTAAAATCACACCAGTGG - Exonic
1185884089 X:3766640-3766662 CTAGTTTACATTCCCACCAGTGG + Intergenic
1186018447 X:5226178-5226200 CTAGTTTACATTCCCACCAGTGG - Intergenic
1186348862 X:8722801-8722823 CTAGTTTACATTCCCACCAGTGG + Intronic
1186798797 X:13072363-13072385 CCAGTTTGACAGCACAACAGTGG - Intergenic
1187592492 X:20733612-20733634 CTGGTTTAAAAGCACACCACTGG + Intergenic
1188022068 X:25170036-25170058 CCAATTTACCAGCGCACCACTGG - Intergenic
1188718661 X:33496293-33496315 CCATTTCACCAGCACACCTGTGG - Intergenic
1189914807 X:45846424-45846446 GTAGATTTCCAGCACTCCAGAGG - Intergenic
1191636051 X:63378278-63378300 CAGGTTTACCAGCACACCACTGG - Intergenic
1197054927 X:122106390-122106412 CTAGTTTACAAGCCCACCAATGG - Intergenic
1197074088 X:122334979-122335001 CTGGTTTACCAGCACAGTACTGG - Intergenic
1197163236 X:123346931-123346953 CCAGTTTTCCAGCATACCACTGG - Intronic
1197651613 X:129071618-129071640 CCAATTTACCAGCACACCACAGG + Intergenic
1198515430 X:137401769-137401791 CCAGTTTACCAGTACTCCACTGG - Intergenic
1199544778 X:148996294-148996316 ACATTTTACCAGCACACCACTGG - Exonic
1201414352 Y:13732943-13732965 CTAGTTTACATTCCCACCAGCGG + Intergenic