ID: 929299991

View in Genome Browser
Species Human (GRCh38)
Location 2:40292383-40292405
Sequence TGTGAGAGTCCCTGTTTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 257}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929299991_929299995 21 Left 929299991 2:40292383-40292405 CCAAACAAACAGGGACTCTCACA 0: 1
1: 0
2: 3
3: 17
4: 257
Right 929299995 2:40292427-40292449 CAGTGTCTAAGCTAGATTTTTGG 0: 1
1: 0
2: 0
3: 15
4: 143
929299991_929299996 22 Left 929299991 2:40292383-40292405 CCAAACAAACAGGGACTCTCACA 0: 1
1: 0
2: 3
3: 17
4: 257
Right 929299996 2:40292428-40292450 AGTGTCTAAGCTAGATTTTTGGG 0: 1
1: 0
2: 0
3: 13
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929299991 Original CRISPR TGTGAGAGTCCCTGTTTGTT TGG (reversed) Intronic