ID: 929299995

View in Genome Browser
Species Human (GRCh38)
Location 2:40292427-40292449
Sequence CAGTGTCTAAGCTAGATTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929299991_929299995 21 Left 929299991 2:40292383-40292405 CCAAACAAACAGGGACTCTCACA 0: 1
1: 0
2: 3
3: 17
4: 257
Right 929299995 2:40292427-40292449 CAGTGTCTAAGCTAGATTTTTGG 0: 1
1: 0
2: 0
3: 15
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929299995 Original CRISPR CAGTGTCTAAGCTAGATTTT TGG Intronic