ID: 929299996

View in Genome Browser
Species Human (GRCh38)
Location 2:40292428-40292450
Sequence AGTGTCTAAGCTAGATTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929299991_929299996 22 Left 929299991 2:40292383-40292405 CCAAACAAACAGGGACTCTCACA 0: 1
1: 0
2: 3
3: 17
4: 257
Right 929299996 2:40292428-40292450 AGTGTCTAAGCTAGATTTTTGGG 0: 1
1: 0
2: 0
3: 13
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929299996 Original CRISPR AGTGTCTAAGCTAGATTTTT GGG Intronic