ID: 929301394

View in Genome Browser
Species Human (GRCh38)
Location 2:40307684-40307706
Sequence CTGGTTACCAGAGGTGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 188}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929301394 Original CRISPR CTGGTTACCAGAGGTGTGTC TGG Intronic
900398451 1:2462841-2462863 CTGGTGCCAAGATGTGTGTCGGG + Intronic
902258467 1:15206322-15206344 CTTCTTCCCAGAGGTGTTTCAGG - Intronic
902258488 1:15206410-15206432 GAGGTTCCCAGAGGTGTTTCAGG - Intronic
904276469 1:29388098-29388120 CTGATTACCAGAGGGGCGGCTGG + Intergenic
908232136 1:62115748-62115770 CTAGTCACCAGAGGTCTGTGAGG - Intronic
908410306 1:63857813-63857835 TTGGTTACCAAAGGTGACTCTGG + Intronic
912394924 1:109335129-109335151 TTGGTTACAAGGGGTGTGTCAGG + Intronic
913494965 1:119420078-119420100 CTGGTTCACAGAGGTCTGTCAGG + Intronic
913497692 1:119443545-119443567 CTGGTTCACAGAGGTCTGTCAGG + Intergenic
913508751 1:119543457-119543479 CTGGTTCACAGAGGTCTGTCAGG + Intergenic
913511867 1:119569425-119569447 CTGGTTCTCAGAGGTCTGTCAGG + Intergenic
918042028 1:180919357-180919379 CTGGGGACCAGAGGAGGGTCTGG - Intronic
919636337 1:200006970-200006992 CTGATAACCAGAGGTGTGTAGGG - Intergenic
921779156 1:219141155-219141177 TAGGTTTCCAGATGTGTGTCAGG - Intergenic
923505933 1:234607399-234607421 CTGGTTGCCAGAGAGGAGTCCGG + Exonic
924284042 1:242466935-242466957 CTGGTTACCAGGGCTGAGTGGGG + Intronic
924889875 1:248263762-248263784 CTGGTTAGAAGACATGTGTCTGG + Intergenic
1065291452 10:24234293-24234315 CTTGGGACCAGAGGTGTTTCAGG - Intronic
1065984022 10:30931327-30931349 ATGGTTTCCAGAGGTGCATCTGG - Intronic
1066555484 10:36608171-36608193 GTGGTTGCCAGGGGTGTGTGGGG - Intergenic
1067306326 10:45067737-45067759 ATGGTTACCAGAGGTATGAAGGG - Intergenic
1068299802 10:55123972-55123994 CTGGTAACCATAGCAGTGTCTGG + Intronic
1068649410 10:59504842-59504864 GTGGTTACCAGGGGTGTGGGGGG - Intergenic
1070843212 10:79502533-79502555 CTGTTTGCCAGAGCTGTGGCTGG + Intergenic
1070930458 10:80257101-80257123 CTGTTTGCCAGAGCTGTGGCTGG - Intergenic
1074944972 10:118272463-118272485 CTCATTACCAGAGGTTTGTATGG - Intergenic
1077259769 11:1610106-1610128 CTGGTCAGCAGAGCTGTGCCTGG - Intergenic
1077557878 11:3234741-3234763 CAGGCTACCAGAGGCTTGTCTGG + Intergenic
1077682490 11:4255799-4255821 TTGGTTACCAGAGGTGTGGATGG - Intergenic
1077687543 11:4310940-4310962 TTGGTTACCAGAGGTGTGGATGG + Intergenic
1077692711 11:4362128-4362150 TTGGTTACCAGAGGTGTGGATGG + Intergenic
1078531585 11:12140624-12140646 CTAGTTCCCAGAGGTATGGCTGG - Intronic
1085715294 11:78867261-78867283 ATGGTTACCAGAGGTTTGGAAGG - Intronic
1086545461 11:87962476-87962498 GTGGTTACCAGAGGCTTGGCGGG + Intergenic
1090030512 11:123202203-123202225 CTGGTGACCAGATGTATGCCTGG + Intergenic
1090081325 11:123614819-123614841 CTGGTTATCAGCTGTGTGTAAGG + Exonic
1090324429 11:125872260-125872282 CAGGTGACCAGAGGTGACTCAGG + Intergenic
1092330692 12:7584235-7584257 CAGGTGACCAGAGGTGACTCAGG - Intergenic
1094739103 12:33268402-33268424 CTGGTTACCAGAGGTTGGGGTGG + Intergenic
1095277023 12:40298151-40298173 CTAGTTACCAGAGGTGTGTAAGG + Intronic
1096233530 12:49910650-49910672 CTGGTCAGCACAGGAGTGTCAGG - Intergenic
1100688537 12:97013112-97013134 CTGGTTACCATACCTGTGCCTGG + Intergenic
1102496072 12:113320465-113320487 CTGGTTACCACAGTGGTGGCCGG - Exonic
1102625069 12:114228288-114228310 CTGGTTAACAGAATTGTGGCCGG - Intergenic
1104587509 12:130059364-130059386 CTGGTTCCCCTTGGTGTGTCTGG + Intergenic
1105539593 13:21304033-21304055 GTGGTTGCCAGAGGTTAGTCGGG - Intergenic
1105716747 13:23073672-23073694 CTAGGTACCAGAGGAGTGTTAGG - Intergenic
1105776740 13:23669370-23669392 CTGGTTGAGAGAGGTGAGTCGGG + Intronic
1107582876 13:41810607-41810629 ATGGTTACCAGAGGTGGGAAGGG + Intronic
1108364144 13:49693126-49693148 ATGGTTACCAGGGGTGGGGCGGG + Intergenic
1108458791 13:50644246-50644268 CTGGTGCCCAGAGCAGTGTCTGG - Intronic
1112523039 13:100115254-100115276 ATGGTTACCAGAGGCTTGGCAGG + Intronic
1113631376 13:111887315-111887337 CTGGTTACTAGACCTATGTCAGG + Intergenic
1114339248 14:21725830-21725852 GTGGTTACCAGAGGCTTGTGAGG + Intergenic
1115225838 14:31101300-31101322 CTGGTTTCCTGAGGTTTGTGAGG - Exonic
1115400872 14:32958500-32958522 TTGGTTTCCAGAGTTCTGTCTGG + Intronic
1116577650 14:46595366-46595388 GTGGTTACCAGAGGCTGGTCAGG - Intergenic
1116584152 14:46680736-46680758 GTGGTTTCCAGAGGTGTACCAGG - Intergenic
1118163248 14:63311629-63311651 CTGGCTCCCAGGGGTATGTCTGG + Intergenic
1119784533 14:77302481-77302503 CTGGTTACAAGAGGTGGGTGGGG + Intronic
1120031937 14:79651646-79651668 CTGGTTATCAAAGATGTCTCTGG + Intronic
1122263591 14:100536630-100536652 CAGTTTCCCTGAGGTGTGTCTGG - Intergenic
1126532937 15:49731308-49731330 CTGGCTACCAGTGGTGGGTGAGG - Intergenic
1126798786 15:52281887-52281909 CTAGATCCCAGAGGTGGGTCTGG - Intronic
1127332205 15:57950368-57950390 CTGCTTCACAGAGGTGTGTGGGG - Intergenic
1127842697 15:62844732-62844754 ATAGTTACCAGAGGTATGTCAGG + Intergenic
1130563118 15:84974161-84974183 CTGGTTACCAAAAGTATGTGAGG - Intergenic
1130855966 15:87840519-87840541 GTGGTTACCAGGGGTGGGTGGGG + Intergenic
1132130228 15:99270446-99270468 CTGGTTACCAGGGCTGGGTGTGG - Intronic
1132229727 15:100172516-100172538 GAGGTGACCAGAGGTGAGTCAGG - Intronic
1136356601 16:29748336-29748358 CTGCTTGCCAGAGGTGTGGAGGG + Intergenic
1138709407 16:58952709-58952731 ATGGTTACCAGAGGTTTGAAAGG - Intergenic
1142582438 17:950438-950460 CTGGTTTTCAGGGGTGTGTGGGG + Intronic
1145415428 17:22710349-22710371 CTGTTAACCAGAGGTGGCTCTGG + Intergenic
1145889821 17:28406401-28406423 CTTGTTATCTGTGGTGTGTCTGG - Intronic
1149962617 17:61128674-61128696 CTGGTTTCCAGATGTTTGACAGG - Intronic
1150305906 17:64085112-64085134 TTGGTTACCACCTGTGTGTCAGG - Intronic
1154042183 18:10866689-10866711 CTGGTGACCAGGGATGTGGCTGG + Intronic
1154330194 18:13423054-13423076 CTGGACACCAGTGGTGTGGCAGG - Intronic
1156123521 18:33874807-33874829 CTGGTTTACAGTGGTGTGACTGG - Intronic
1159923347 18:74246562-74246584 CTGCTTAGCGGAGGTGTGGCCGG - Intergenic
1160154240 18:76421321-76421343 CTGGCTGCCAGAGGTATGGCGGG + Intronic
1161085806 19:2334355-2334377 CTGGTGACCATGAGTGTGTCAGG - Intronic
1161569494 19:5022786-5022808 CAGTTTACCCGAGGTGTGCCGGG + Intronic
1164521159 19:28981419-28981441 GTGGTGACCAGAGGTGGGGCAGG - Intergenic
1166422499 19:42649974-42649996 CTGATGACCAGAGCTGTGTGTGG - Intronic
1166909342 19:46140723-46140745 CTGGTTCCCACAGGGGTTTCTGG - Intergenic
1166923695 19:46250596-46250618 CTGGTTCCCACAGGGGTTTCTGG + Intergenic
1166923978 19:46252846-46252868 CTGGTTCCCACAGGGGTTTCTGG + Intergenic
1168499480 19:56881216-56881238 CTTGGGACCAGAGGTGTTTCAGG + Intergenic
929301394 2:40307684-40307706 CTGGTTACCAGAGGTGTGTCTGG + Intronic
929475061 2:42238213-42238235 CTTGGTACCAGAAGTGTTTCAGG - Intronic
929595198 2:43171167-43171189 CTGGTCTCCAGAGCTGTGTGGGG + Intergenic
930174213 2:48285132-48285154 CTGGTGACCAGGGGTGACTCAGG - Intergenic
930651331 2:53967736-53967758 CTGGACATCAGAGGTGTGTTTGG - Intronic
933883428 2:86695190-86695212 CAGGTGACCAGAGGTGACTCAGG - Intronic
935082425 2:99811118-99811140 CTGCCTACCACATGTGTGTCTGG + Intronic
935544108 2:104382766-104382788 ATGGTGACCAGAGGTGAGTGGGG + Intergenic
937716564 2:125039162-125039184 CTGGTTAGCTGAGGTGTTGCAGG + Intergenic
937726902 2:125177010-125177032 GTGGTTACCAGGAGTGGGTCTGG - Intergenic
946516028 2:220412434-220412456 CTGGTTACCAGTGGTGAGAGTGG + Intergenic
947016560 2:225627048-225627070 CTGGTGACCACAGGTGTCCCTGG - Exonic
948965039 2:241372694-241372716 CTGGTGGCGAGAGGTGTGCCAGG + Intronic
1169060516 20:2657510-2657532 CTTATTATCAGACGTGTGTCCGG + Intronic
1169761513 20:9100189-9100211 CTGGTCACCACAGGTGGCTCTGG - Intronic
1173774654 20:45694021-45694043 CTGGATACTAGACGTTTGTCAGG + Intronic
1178827535 21:36029291-36029313 CTGGTTTTCAGAGGTGTGGGAGG - Intergenic
1179523998 21:41963897-41963919 CTTGTTGATAGAGGTGTGTCCGG + Intergenic
1180692035 22:17725009-17725031 CTGCTTATCAGGGTTGTGTCAGG - Intronic
1181107629 22:20584438-20584460 CTGGTTCCCCTAGGGGTGTCTGG - Intronic
1182379077 22:29871928-29871950 CTGGTTGACAGACGGGTGTCTGG + Intergenic
1182462879 22:30494886-30494908 CTGGCTTCCACAGGTGTTTCAGG + Exonic
1183581976 22:38731620-38731642 CTGGTTACCAGAAGGGGGTCTGG + Exonic
1185375315 22:50480327-50480349 CTGGTGACCAGTGGGGTGACAGG - Intergenic
950231086 3:11276475-11276497 CTGGGTAAAAGAGGTGTGACAGG - Intronic
950722567 3:14894118-14894140 GTGGTTACCAGAGGTGGGAAGGG - Intronic
950801769 3:15557771-15557793 TCGGCTGCCAGAGGTGTGTCCGG + Intergenic
951195807 3:19822186-19822208 GAGGTTACCAGAGGTGGGTAGGG - Intergenic
951255681 3:20446825-20446847 CTGGTTACCACAGTAGTGTCTGG - Intergenic
952529602 3:34249630-34249652 CTGGACACCACAGGTGTGCCTGG - Intergenic
953311344 3:41882916-41882938 TTGGTTCTCAGAGATGTGTCAGG - Intronic
953797559 3:45997108-45997130 TTGGTGACCAGATGTGTGTGGGG + Intergenic
956861568 3:73329144-73329166 GTGGGGACCAGAGGTATGTCAGG + Intergenic
957549339 3:81683735-81683757 TTGGTTACCAAACATGTGTCTGG - Intronic
962648209 3:137461809-137461831 CTGCCTCCCAGAGGTATGTCTGG + Intergenic
962753309 3:138450463-138450485 CTGGTTCCCAGAGGTGCAGCTGG - Intronic
964400228 3:156290785-156290807 CTGGCTACCAGAGGAGGGACTGG - Intronic
965670678 3:171144771-171144793 GTGGTTACCAGAGGATTGGCAGG - Intronic
966198944 3:177341477-177341499 GTGGTTACTAGAGGTGGGACAGG - Intergenic
966911757 3:184563781-184563803 CTAGTTGCCAGATCTGTGTCTGG + Intronic
967228715 3:187317800-187317822 CTGCTTACTAAAGGTGTGACTGG + Intergenic
969522834 4:7688813-7688835 CTGGGTCCCAGAGGTCTGGCTGG - Intronic
970445985 4:16123695-16123717 CTGGCTCCCAGAGGTGTGAGAGG - Intergenic
971375512 4:26052807-26052829 CTGCTAACAACAGGTGTGTCAGG + Intergenic
974652382 4:64771198-64771220 TTAGTTACCAGAGGTGTTACAGG - Intergenic
975761692 4:77626358-77626380 GTGGTTACCAGAGGTGAGGTGGG - Intergenic
981077716 4:140607539-140607561 CTGGTTACCAGAGTGTGGTCTGG + Intergenic
981537843 4:145818774-145818796 CTTCTGACCAGGGGTGTGTCAGG + Intronic
984287393 4:177749577-177749599 GTGATTACCAGAGGTGGGTGAGG - Intronic
985584370 5:721691-721713 CAGGACACCAGAGGTGTGGCAGG + Intronic
985597876 5:806022-806044 CAGGACACCAGAGGTGTGGCAGG + Intronic
985867687 5:2528100-2528122 GTGGTTACCAGAGGTGAGGGAGG + Intergenic
986266844 5:6198015-6198037 CTGGTGAGCAGAAGTGTGTCTGG - Intergenic
986643095 5:9891180-9891202 CTGTTTTCCAGATGTGTGGCTGG - Intergenic
993554904 5:89324241-89324263 GTGGTTACCAGAGGCTTGTTGGG - Intergenic
994093421 5:95827900-95827922 CTAGTTAACAGAAGTGTGTATGG + Intergenic
995849639 5:116531807-116531829 CAGGTGACCAGAGGTGACTCAGG - Intronic
995850914 5:116545036-116545058 CAGGTGACCAGAGGTGACTCAGG - Intronic
996370853 5:122751234-122751256 CTGGTCACCAAAGCTGTGACAGG - Intergenic
996928039 5:128852387-128852409 ATGGTTACCAGAGGTGGGGAAGG + Intronic
999667118 5:153924552-153924574 ATGGTTACCAGAGGTGGGGAAGG + Intergenic
1002758628 6:184443-184465 CTGTTTACTCGAGGTGTGGCGGG - Intergenic
1003257566 6:4487743-4487765 CAGGTGACCAGAGGTGACTCAGG - Intergenic
1003975149 6:11336001-11336023 CTGGTAACCAGGAGTCTGTCTGG + Intronic
1004418336 6:15445623-15445645 CTTGTTGCATGAGGTGTGTCAGG + Intronic
1004466909 6:15894442-15894464 CTGGGTACCCAAGGTGTGTATGG - Intergenic
1004752270 6:18574553-18574575 ATGGTTACCAGAGGTTGGTAAGG - Intergenic
1006694262 6:35917989-35918011 CTAGTTACAGGAGGTGAGTCAGG - Intronic
1006838062 6:37011127-37011149 CTGCTCACCAGAGCTGAGTCAGG + Intronic
1009568528 6:65347884-65347906 ATGGTTACCAGAGGTTTGGAAGG - Intronic
1012672605 6:102073990-102074012 CAGGTGACCAGGGGTGTCTCAGG + Intergenic
1013292827 6:108733264-108733286 CTGGTCCCCAGAGGTGTCACTGG - Intergenic
1014260224 6:119207850-119207872 CCGGTTACCAAAGGTGAGGCTGG + Intronic
1014344335 6:120248974-120248996 ATGGTTACCAGAGGTTTGGAAGG + Intergenic
1016126207 6:140407575-140407597 ATTGGTACCAGAGGTGTGTGGGG + Intergenic
1017714143 6:157196459-157196481 CTGGTCACCAGGTGAGTGTCAGG + Intronic
1018786033 6:167108703-167108725 CTGGTTGCCAGGTGTGTGCCAGG + Intergenic
1019270166 7:142518-142540 CTGGTTCACAGATGTCTGTCAGG - Intergenic
1020315353 7:6901723-6901745 CTGGTTTACAGAGGTGCTTCAGG - Intergenic
1024603752 7:51008778-51008800 CTGTGTATCAAAGGTGTGTCTGG - Intergenic
1024674429 7:51625407-51625429 GTGGTTACCAGAGGTGGGGAGGG - Intergenic
1024896811 7:54270005-54270027 ATGGTTAGCAGGGGTGTGACGGG - Intergenic
1026116324 7:67498736-67498758 CGGGTCACAAGAGGAGTGTCAGG - Intergenic
1026639992 7:72115829-72115851 CTGGTTACCAGAGGTAAGGAAGG - Intronic
1028929781 7:96399739-96399761 GTGGTTACCTAAGGTGGGTCTGG + Intergenic
1034709972 7:153182753-153182775 CTGGTCAGCAGAGGTTTGGCAGG + Intergenic
1035365286 7:158345346-158345368 CTGGTAACCAGAGCTTTGTCTGG + Intronic
1036158258 8:6362588-6362610 GTGGTTACCAGAGCTGGGCCTGG - Intergenic
1040570029 8:48600335-48600357 CTGTTTACCCGAGGTGTCACAGG + Intergenic
1040748971 8:50682391-50682413 CAGGTGACCAGAGGTGACTCAGG + Intronic
1042071191 8:64936435-64936457 GTGGTTACCAGAGGTGGGGAAGG - Intergenic
1042629759 8:70804073-70804095 CTGGCTACCAGTGGTGAGTGTGG + Intergenic
1043278129 8:78427365-78427387 CTGGTCACAAGAGGTGGTTCTGG - Intergenic
1045801082 8:106101993-106102015 ATGGTTACCAGAGGCTTGGCAGG + Intergenic
1046463824 8:114576249-114576271 GTGGTTACAAGAGATGTGTATGG - Intergenic
1047381166 8:124364928-124364950 CTGGTTTCCTTTGGTGTGTCTGG - Intronic
1047875723 8:129135554-129135576 CTGATTAACAGAGTTATGTCTGG - Intergenic
1048541182 8:135343547-135343569 GTGGTTACCAGGGGTGGGTTAGG + Intergenic
1049579419 8:143404608-143404630 CTGGTTATCAGAGGAGAGGCTGG + Intergenic
1051861264 9:21627566-21627588 CTGGCTACCAGAGGTGGGAGTGG - Intergenic
1055904277 9:81274740-81274762 GTGGTTACCAGAGGTTGGACAGG + Intergenic
1062002691 9:134224872-134224894 CTGGTGCCCAGGGGTGGGTCAGG - Intergenic
1186078869 X:5908947-5908969 CTGGTTACCAGAAGTCACTCTGG - Intronic
1188049499 X:25467184-25467206 GTGGTTACCAGAGGCTTGGCGGG - Intergenic
1189553415 X:42116202-42116224 GTGGTTACCAGAGGTGGGGGTGG + Intergenic
1191039908 X:56068135-56068157 CTGGCTATCAGTGGTGTGGCTGG - Intergenic
1191763829 X:64673897-64673919 GTAGTTACCAGTGGTGTGTGGGG + Intergenic
1192220163 X:69192250-69192272 CTGGTGAGCAGAGGTGAGGCAGG + Intergenic
1193166657 X:78288863-78288885 GTGGTTACCAGAGGTTTGGAAGG - Intronic
1193204304 X:78729759-78729781 ATGGTTACCAGAGGTTGGTAAGG - Intergenic
1195406560 X:104520837-104520859 ATGGTTACCAGAGGTGGGAAGGG - Intergenic
1195958128 X:110356056-110356078 GTGGTTACCAGAGGTTAGTGGGG + Intronic
1196481322 X:116153226-116153248 ATGGTTACCAGAGGCTTGGCAGG + Intergenic
1196620716 X:117820666-117820688 CTGGTTACTAGAGGGGAGTGAGG + Intergenic
1199324105 X:146476784-146476806 CTGATTACCAGAGTGGGGTCTGG - Intergenic