ID: 929302640

View in Genome Browser
Species Human (GRCh38)
Location 2:40323671-40323693
Sequence CCCCCTTAGGAACTGGGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 238}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929302640_929302646 13 Left 929302640 2:40323671-40323693 CCAATGCCCAGTTCCTAAGGGGG 0: 1
1: 0
2: 0
3: 18
4: 238
Right 929302646 2:40323707-40323729 AACAAACCCTCCTACCCAAACGG 0: 1
1: 0
2: 0
3: 11
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929302640 Original CRISPR CCCCCTTAGGAACTGGGCAT TGG (reversed) Intronic
904985949 1:34549135-34549157 CCCACTGAGGGACAGGGCATTGG + Intergenic
905487397 1:38312476-38312498 CCCCCTTAAGAAGTGGGCAAAGG + Intergenic
906811729 1:48833974-48833996 GCCCCTAAGGTACTGGGCAGGGG - Intronic
906906711 1:49902352-49902374 CCCCATTAAAAACTGGGCAAAGG + Intronic
909089150 1:71204456-71204478 CGTCCTTAGGAAATGGGCTTTGG + Intergenic
909577965 1:77196639-77196661 CCCCATTAAAAACTGGGCAAAGG - Intronic
910167495 1:84343025-84343047 CCCCATTAAAAACTGGGCAAAGG + Intronic
912028287 1:105206006-105206028 CTCCCATAGGAACTTGGCACAGG + Intergenic
912429867 1:109623451-109623473 CCCCCTGAGCAGCTGGGCAGCGG + Intronic
912609060 1:111024592-111024614 CCCCATTAGAAAGTGGGCAAAGG + Intergenic
912613195 1:111069642-111069664 CCCCATTAGAAAGTGGGCAAAGG - Intergenic
913348389 1:117830463-117830485 GCACCTTTGGAACTGGGCAATGG + Intergenic
913596400 1:120382330-120382352 CCCCATTAAAAACTGGGCAAAGG + Intergenic
914090870 1:144496644-144496666 CCCCATTAAAAACTGGGCAAAGG - Intergenic
914307734 1:146437564-146437586 CCCCATTAAAAACTGGGCAAAGG + Intergenic
914594377 1:149135568-149135590 CCCCATTAAAAACTGGGCAAAGG - Intergenic
914968770 1:152287623-152287645 CCCCATTAAAAACTGGGCAAAGG + Intergenic
915206406 1:154273451-154273473 CCCCCTGAGGAATTTGGCTTCGG + Exonic
916151691 1:161798766-161798788 CCCCATTAAGAAGTGGGCAAAGG + Intronic
918473207 1:184896380-184896402 CCCCATTAAAAACTGGGCAAAGG - Intronic
919049347 1:192494354-192494376 CCCCATTAAAAACTGGGCAAGGG + Intergenic
919831797 1:201546383-201546405 TCCCCCTGGGAACTGCGCATGGG - Intergenic
923426942 1:233880131-233880153 CCCCATTAAAAACTGGGCAAAGG - Intergenic
923499325 1:234551268-234551290 CCCCTTTGGGACCTGGGCCTCGG - Intergenic
1062789262 10:291086-291108 CCCCCTTAGTGGCTGGGCACAGG - Intronic
1062849668 10:734441-734463 CCCCATTACAAACTGGGCAAAGG + Intergenic
1063885459 10:10573173-10573195 CCCCATTAGAAAGTGGGCAAAGG - Intergenic
1066490948 10:35894051-35894073 CCCCATTACGAAGTGGGCAAAGG + Intergenic
1067562694 10:47314875-47314897 CTCCCACAGGAACTGGACATGGG + Intergenic
1067867545 10:49925023-49925045 CCCTATTATGAACTGTGCATGGG + Intronic
1067894795 10:50167259-50167281 TCCTCTTAGGAACAAGGCATTGG - Intergenic
1067954043 10:50773003-50773025 TCCTCTTAGGAACAAGGCATTGG + Intronic
1070266116 10:74904813-74904835 CCCCTTTAGTAACTGGGGAATGG + Intronic
1070993692 10:80755894-80755916 CCCCTGTAGGAATGGGGCATGGG - Intergenic
1072732560 10:97856901-97856923 CCCCATTAAAAACTGGGCAAAGG - Intronic
1072908688 10:99480434-99480456 CCCCCTTAAAAAATGGGCAAAGG + Intergenic
1072916886 10:99542685-99542707 CTCCCTTAGGAACTAGACCTAGG + Intergenic
1075656102 10:124162295-124162317 CCACCTCAGGGACTGGGCACAGG - Intergenic
1075927845 10:126267547-126267569 CCCTCTTGTGAACTGTGCATGGG - Intronic
1078630274 11:12996509-12996531 CCCCATTAAAAACTGGGCAAAGG - Intergenic
1079113604 11:17623969-17623991 CCCCATTAAAAACTGGGCAAAGG - Intronic
1079763071 11:24355686-24355708 CTCCCATAGGAACTTGGCATGGG - Intergenic
1082814938 11:57501423-57501445 CCCCCAAAGGCACTTGGCATGGG - Intronic
1083290863 11:61689226-61689248 TCCCCTTAGCCACTGGGCCTAGG - Intronic
1084683743 11:70681725-70681747 CTCCATTAGGTACTGGGCTTGGG - Intronic
1086925217 11:92632683-92632705 TTCCCTTAGGAACTGGTCAGGGG - Intronic
1087001928 11:93429872-93429894 CTCTTCTAGGAACTGGGCATGGG + Intronic
1088037789 11:105338360-105338382 CCCCATTAGAAAGTGGGCAAAGG + Intergenic
1088362527 11:109006143-109006165 CCCCCTTAAAAAGTGGGCAAAGG + Intergenic
1088695879 11:112365555-112365577 CTCCCTTAGGACCTCAGCATGGG + Intergenic
1089030121 11:115317566-115317588 GCCCCTTGGGAACTGGTCAGAGG - Intronic
1089467168 11:118692792-118692814 TCCCCGTGGGAACAGGGCATGGG + Intergenic
1090072993 11:123560492-123560514 CCCCGTTAGAAACAGGGCTTTGG + Intronic
1092335787 12:7631779-7631801 CCCCATTAAAAACTGGGCAAAGG - Intergenic
1092519418 12:9252514-9252536 CCCCCTTAAAAAGTGGGCAAAGG + Intergenic
1093218602 12:16391569-16391591 CCCCATTAAGAAGTGGGCAAAGG - Intronic
1093460387 12:19402538-19402560 CCCCCATGAGAACTTGGCATAGG - Intergenic
1093684070 12:22036536-22036558 TCTGCTTAGGAACAGGGCATTGG + Intergenic
1094231369 12:28107778-28107800 CCCCGTTAAAAACTGGGCAAAGG + Intergenic
1094234923 12:28152767-28152789 CCCCATTAAAAACTGGGCAAAGG - Intronic
1095620122 12:44243077-44243099 CCCCATTAAGAAGTGGGCAAAGG - Intronic
1099663899 12:85601344-85601366 CCCCATTTGGAACTGACCATTGG - Intergenic
1099709046 12:86196410-86196432 GCCCCTGAGGTACTGGGCAGTGG + Intronic
1100914492 12:99403458-99403480 CCCCATTAAAAAGTGGGCATTGG - Intronic
1100950535 12:99844070-99844092 CCCCATTAAGAAGTGGGCAAAGG - Intronic
1101051021 12:100864266-100864288 CCCCATTTGGAGCTGGGTATGGG + Intronic
1105873327 13:24529645-24529667 CCCCATGAGGGACTGGGCTTGGG - Intergenic
1105957841 13:25301046-25301068 CCCCCTTCGGGGCTGGGCGTCGG + Intergenic
1106085995 13:26541967-26541989 CCCCCTTTGGAGCTGTACATGGG + Intergenic
1106144572 13:27039816-27039838 CCACCTTTGGGACTGGGCTTTGG - Intergenic
1106963135 13:35024995-35025017 CCCCATTAAGAAATGGGCAAAGG - Intronic
1109904857 13:68827324-68827346 CCCCATAAGAAACTGGGCAAAGG + Intergenic
1110146926 13:72203034-72203056 CCCTATTGTGAACTGGGCATGGG + Intergenic
1110221681 13:73080610-73080632 CCCCCTGGGAAACTGGGAATGGG + Intergenic
1110493600 13:76138397-76138419 CCCCATTACAAACTGGGCAAAGG - Intergenic
1112830670 13:103446237-103446259 CCCCATTACGAAGTGGGCAAAGG + Intergenic
1113247685 13:108416735-108416757 CCCCATTAAAAACTGGGCAAAGG - Intergenic
1114567540 14:23643682-23643704 CACCCTTAGGAACTGGCCAGGGG + Intronic
1114831504 14:26148103-26148125 TCCCATTAGAAACTGGGCAAAGG + Intergenic
1115391900 14:32863255-32863277 CCCCATTAGAAAGTGGGCAAAGG - Intergenic
1116224070 14:42125630-42125652 CCCCATTAAAAACTGGGCAAAGG + Intergenic
1116364907 14:44047821-44047843 CCCCATTAAAAACTGGGCAAAGG + Intergenic
1117234559 14:53757810-53757832 CCCCCTTAGAAAGTGGGCAATGG + Intergenic
1119555719 14:75550850-75550872 TCCCCTTAGTAACTGGCCCTGGG - Intergenic
1121028140 14:90631944-90631966 CCCCTTTAGGAAATGGGCAAAGG - Intronic
1122244680 14:100394128-100394150 CACCCTTAGGAACACGGCTTAGG - Intronic
1123883379 15:24696864-24696886 CTCCCTTAGGACCTCAGCATGGG - Intergenic
1124450317 15:29782853-29782875 CCCCATTAGAAAGTGGGCAAAGG + Intronic
1126897875 15:53279343-53279365 CCCCCTTAAAAAGTGGGCAAAGG + Intergenic
1128431207 15:67596290-67596312 CCACCTAAGTAGCTGGGCATGGG - Intronic
1128495877 15:68198211-68198233 ACCCCTTTGGAGCTGGACATGGG + Intronic
1129466355 15:75726226-75726248 CACCCTTAGGACCTGGGCAGGGG + Intronic
1130538796 15:84806263-84806285 GAGCCTTAGGAACTGGGCACAGG + Exonic
1132286784 15:100669324-100669346 ACCCCTTCAGAGCTGGGCATGGG - Intergenic
1132498462 16:274662-274684 CTCCCTCAGGACCTGGGCCTAGG + Intronic
1132508535 16:324903-324925 CGCCCTTAGGAACTGTGCACCGG - Intronic
1134297077 16:12956072-12956094 CCCCGTTAAAAACTGGGCAAAGG + Intronic
1135997535 16:27262862-27262884 CCCCATTAAAAACTGGGCAAAGG + Intronic
1137312805 16:47282909-47282931 CCCCATTAAAAACTGGGCAAAGG - Intronic
1138203992 16:55111171-55111193 CCCCATTAAAAACTGGGCAAAGG - Intergenic
1142030319 16:87835301-87835323 CCCCATGGGGACCTGGGCATGGG - Intronic
1142853503 17:2716924-2716946 CCCCCTAGGGAACTGTGCAAAGG - Intergenic
1144819224 17:18059783-18059805 CCACTTTAGGAAGTGGGGATCGG + Intronic
1145277947 17:21446549-21446571 CCCCATTAAAAACTGGGCAAAGG - Intergenic
1145315772 17:21732420-21732442 CCCCATTAAAAACTGGGCAAAGG - Intergenic
1145714199 17:27004350-27004372 CCCCATTAAAAACTGGGCAAAGG - Intergenic
1148739572 17:49884900-49884922 CACCCTGAGGAACTGCTCATTGG + Intergenic
1150323550 17:64237128-64237150 CCCCCTGAACAAGTGGGCATTGG + Intronic
1150845392 17:68651986-68652008 CCTCACTAAGAACTGGGCATGGG + Intergenic
1151875496 17:76865831-76865853 CCCCCTTAGGAAGAGGGAGTGGG + Intergenic
1153466139 18:5389825-5389847 CCCCATTAAGAAGTGGGCAAAGG + Intergenic
1155515260 18:26618024-26618046 CTGCCTTCGTAACTGGGCATAGG - Intronic
1158337632 18:56431018-56431040 CCCCATTAGAAAGTGGGCAAAGG + Intergenic
1159443156 18:68507559-68507581 CCCCCATATGAACTAGTCATTGG + Intergenic
1159564733 18:70035870-70035892 CCCCATTAAGAAGTGGGCAAAGG + Intronic
1160891662 19:1381882-1381904 CACACTCATGAACTGGGCATGGG + Intergenic
1161698836 19:5784290-5784312 CCCACTTAGGGACGGGGCAGGGG + Exonic
1162795163 19:13083257-13083279 GCCCCTTGGGGGCTGGGCATAGG - Intronic
1164448606 19:28338993-28339015 ACCCCTTAAGAAATGGGCAAAGG - Intergenic
1166934368 19:46322000-46322022 CCCCCTGAGGGACTGAGCACTGG - Intronic
1167865632 19:52325080-52325102 CCCCATTAAAAACTGGGCAAAGG + Exonic
925091951 2:1163306-1163328 TCCCAATAGGAAGTGGGCATGGG + Intronic
925378524 2:3406660-3406682 CACCCTTGGGAACAGAGCATGGG - Intronic
925605095 2:5651695-5651717 CCCCATTAAAAACTGGGCAAAGG + Intergenic
927424168 2:22962723-22962745 CTCCCTCAGGGACTGGGCATGGG + Intergenic
927983570 2:27391499-27391521 CCCCCTTAAAAAGTGGGCAAAGG - Intronic
929302640 2:40323671-40323693 CCCCCTTAGGAACTGGGCATTGG - Intronic
930183342 2:48386378-48386400 CCCGGTTTGGAACAGGGCATGGG - Intergenic
930592159 2:53340990-53341012 CCCCATTAGAAAGTGGGCAAAGG - Intergenic
931980223 2:67686357-67686379 CCCCTTAAGGAAATAGGCATGGG - Intergenic
932270022 2:70401121-70401143 CACCCTATGGAACTGGACATGGG - Intergenic
934612534 2:95751882-95751904 ACCCCTTAGGGGCTGGGCAGTGG - Intergenic
934841614 2:97627562-97627584 ACCCCTTAGGGGCTGGGCAGTGG + Intergenic
934865255 2:97803792-97803814 GCCCCTTAGCAGCTGAGCATAGG + Intronic
938753368 2:134356769-134356791 CCCCCTCAGGACCTTTGCATTGG + Intronic
939508374 2:143076245-143076267 CCCCATTAGGGACTCTGCATGGG - Intergenic
940149404 2:150582895-150582917 CCCCATTAGAAAGTGGGCAAAGG + Intergenic
940402514 2:153264108-153264130 CCCCATTAAAAAGTGGGCATAGG + Intergenic
940426692 2:153539214-153539236 CCCCATCAGAAACTGGGCAAAGG - Intergenic
941859037 2:170259884-170259906 CCCCCTTAAAAAGTGGGCAAAGG + Intronic
943178492 2:184510134-184510156 CCCCATTAAAAACTGGGCAAAGG - Intergenic
943700441 2:190983541-190983563 CTCCCTTAACAACTGGCCATTGG + Intronic
944333828 2:198504879-198504901 CCCCATTAAAAACTGGGCAAAGG + Intronic
944338184 2:198563033-198563055 CCCCATTAGAAAGTGGGCAAAGG - Intronic
944338275 2:198564234-198564256 CCCCATTAGAAAGTGGGCAAAGG - Intronic
945760030 2:213903211-213903233 CCCCCGTAGGGACTCTGCATGGG + Intronic
945861653 2:215129552-215129574 CCCCATTAGAAACTGGGCAAAGG - Intronic
946167642 2:217875006-217875028 CCCCCTTTGAAGCTAGGCATGGG + Intronic
949054555 2:241920392-241920414 CCCCATTAAGAAGTGGGCAAAGG + Intergenic
949066343 2:241993126-241993148 CCACCTTAGGAGCTGGGGACGGG - Intergenic
949066353 2:241993165-241993187 CCACCTTAGGAGCTGGGGACGGG - Intergenic
1168829489 20:837439-837461 CTCCCTCAGGAGCTGGGCACTGG + Intronic
1171254266 20:23675475-23675497 CCCCATTAAAAAGTGGGCATAGG - Intergenic
1171937736 20:31291937-31291959 CCCCATTAAAAACTGGGCAAAGG + Intergenic
1173712318 20:45170335-45170357 CCCCATTAGAAAGTGGGCAAAGG + Intergenic
1174916251 20:54657181-54657203 CCCCATTAGAAAGTGGGCAAAGG - Intergenic
1175676664 20:60951987-60952009 CCCTCCTAGGAGCTGGGCATAGG - Intergenic
1179174567 21:38998655-38998677 CCCCCTTAAAAATTGGGCAAAGG - Intergenic
1181313565 22:21958245-21958267 CACCCTCAGGACCTGGGCACAGG - Intronic
1182376391 22:29851550-29851572 CCCCTTTTGGGAATGGGCATTGG - Intergenic
1184834230 22:47011509-47011531 CCGCTCTAGAAACTGGGCATTGG - Intronic
1184907288 22:47497444-47497466 TCCCCTGAGGCACTGTGCATGGG - Intergenic
950100834 3:10355709-10355731 CCCCCTCAGGCCCTGGGCATGGG + Intronic
950513987 3:13452017-13452039 CCCCCACAGGAACTGTGCAGAGG - Intergenic
951979803 3:28552922-28552944 CCCCATTAGAAAGTGGGCAAAGG - Intergenic
952435935 3:33272458-33272480 GCCTGTTAGGAACTGGGCTTGGG + Intergenic
952971099 3:38650753-38650775 TCCCCATAGGTCCTGGGCATGGG - Intergenic
953497601 3:43401972-43401994 CCTCCTTATAACCTGGGCATGGG - Intronic
956244247 3:67163777-67163799 CCCCATTAAAAACTGGGCAAAGG + Intergenic
957822664 3:85398828-85398850 CCCCCTCAACAACTGGGCAAAGG - Intronic
958492475 3:94795151-94795173 CCCCATCAAAAACTGGGCATAGG + Intergenic
958555801 3:95674367-95674389 GCACCTTTGGAACTGGGTATTGG - Intergenic
961417313 3:126768862-126768884 CCCCATTAAGAAGTGGGCAAAGG - Intronic
965266355 3:166548749-166548771 CCCCATTAGGAAATGAGCAGAGG + Intergenic
966007350 3:175031937-175031959 CCCCATTAAAAACTGGGCAAAGG - Intronic
966581064 3:181564155-181564177 AACCCTTATAAACTGGGCATTGG - Intergenic
967243244 3:187462225-187462247 CCACCTGCAGAACTGGGCATGGG - Intergenic
969204675 4:5634656-5634678 CTCCCTTTTGAAGTGGGCATGGG - Intronic
972083777 4:35186961-35186983 CCCCATTAAGAAGTGGGCAAAGG + Intergenic
972403552 4:38726559-38726581 CTCCTTTAGGAAATGGGCTTTGG - Intergenic
974281856 4:59805562-59805584 CCCCCTTAAAAACTGGGCAAAGG - Intergenic
980481173 4:133389504-133389526 CCCCCTTGGGACCTGGGAAAGGG - Intergenic
981288437 4:143046636-143046658 GCCTCTGAGGAACTGGGCAACGG - Intergenic
982179644 4:152738025-152738047 CTCCCTTTGGAAATTGGCATGGG + Intronic
983169181 4:164516434-164516456 CCCCCTTAAAAACTGAGCAAAGG - Intergenic
987470108 5:18317529-18317551 TCACCTTGGGCACTGGGCATGGG - Intergenic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
992021335 5:72627484-72627506 CCCCATTAAAAACTGGGCAAAGG + Intergenic
993263986 5:85697879-85697901 CCCCATTCGAAACTGGGCAAAGG + Intergenic
993821133 5:92618297-92618319 CCCCATTAGAAAGTGGGCAGAGG - Intergenic
995615269 5:113955563-113955585 CCCCATTAGAAAGTGGGCAAAGG - Intergenic
995937983 5:117541059-117541081 CCCCATTAAAAACTGGGCAAAGG + Intergenic
996404235 5:123090411-123090433 CCCCCCAAGGAACTGTGCCTCGG + Exonic
996784292 5:127221869-127221891 CCCCATTAAAAACTGGGCAAAGG + Intergenic
997829734 5:137139664-137139686 CCCACTTGGGAACTGGACATGGG + Intronic
999423303 5:151463993-151464015 GCCATTTAGGAACAGGGCATGGG - Intronic
999737465 5:154523436-154523458 CCCCCTAAAGGACTGGGCATTGG - Intergenic
1000150692 5:158497828-158497850 CCCTCTTAGGCAATGGGAATTGG - Intergenic
1000675869 5:164121847-164121869 CCCCCTCAAAAACTGGGCAAAGG - Intergenic
1001402441 5:171453522-171453544 ACCTCTTTGGAACTGGGCAGAGG + Intronic
1001650825 5:173314872-173314894 CCTCCTTAGGAAGTGGCCACTGG + Exonic
1001942902 5:175753331-175753353 CCCCCTCTGGCACTGGGCATAGG - Intergenic
1001986605 5:176079002-176079024 CCCCATTAAGAAGTGGGCAAAGG - Intronic
1002230262 5:177759136-177759158 CCCCATTAAGAAGTGGGCAAAGG + Intronic
1002265078 5:178024629-178024651 CCCCATTAAGAAGTGGGCAAAGG - Intronic
1005560474 6:27035266-27035288 CACATTGAGGAACTGGGCATGGG - Intergenic
1006653083 6:35567396-35567418 CCTCCCAAGTAACTGGGCATGGG - Intergenic
1007438608 6:41837773-41837795 CCCCATTAGAAAGTGGGCAAAGG + Intronic
1009279382 6:61727603-61727625 CCCCATTAAAAACTGGGCAAAGG + Intronic
1009734968 6:67663839-67663861 CCCACCCAGAAACTGGGCATTGG - Intergenic
1012577097 6:100816077-100816099 TCCCATTAGGAAGTGGGCAAAGG + Intronic
1022432052 7:30333826-30333848 CCCCCTTAAGAAGTGGGCAAAGG - Intronic
1024999693 7:55305173-55305195 CCCCATTAAAAACTGGGCAAAGG + Intergenic
1026088774 7:67283253-67283275 CCCCCTGAGGAGCTGGGACTAGG + Intergenic
1026518246 7:71091741-71091763 CCCCGTTAAAAACTGGGCAAAGG + Intergenic
1026999595 7:74643311-74643333 TCCCCTTATAAACTGTGCATGGG - Intergenic
1027538410 7:79436521-79436543 CCCCATTAAAAACTGGGCAAAGG + Intronic
1028017721 7:85736261-85736283 CTCCCACAGGAACTCGGCATGGG + Intergenic
1028947888 7:96601494-96601516 CCACCTTAGAGACTGGGCACTGG - Intronic
1030308231 7:108041064-108041086 CCCCCTTAAAAAGTGGGCAAAGG + Intronic
1031623545 7:123966088-123966110 CCCCATTAAGAAGTGGGCAAAGG + Intronic
1031882229 7:127210359-127210381 GCCCCTTATGAGCTGGGCATTGG + Intronic
1032202860 7:129835261-129835283 CCCCCTGAGGAAAGGGGTATTGG + Intronic
1032647590 7:133842472-133842494 CCCCATTAAGAAGTGGGCAAAGG - Intronic
1032755900 7:134890669-134890691 CCTCCTCAGGAACTGGGATTTGG + Intronic
1033762400 7:144449821-144449843 CTCTCTTAGGAAATGGGCAGGGG - Intergenic
1037911030 8:22743653-22743675 CAGCCTTAGGAAATGGGCAGGGG + Intronic
1040669573 8:49673235-49673257 CCCCATTAAAAACTGGGCAAAGG + Intergenic
1041077860 8:54185637-54185659 ACCCCATGGGAACTGGGCTTGGG - Intergenic
1041427083 8:57733979-57734001 CCCCATTAAGAAGTGGGCAAAGG - Intergenic
1046195894 8:110861995-110862017 CCCCTAAAGGAACTGGGAATTGG - Intergenic
1048817342 8:138345973-138345995 CCCCATTAAAAACTGGGCAAAGG + Intronic
1049532703 8:143162722-143162744 CCTCCTTAGGGACTGGTAATAGG + Intergenic
1050134198 9:2444238-2444260 CCCCATTAAAAAGTGGGCATAGG - Intergenic
1052185529 9:25589481-25589503 CCTCCTGAGTAGCTGGGCATAGG - Intergenic
1058921681 9:109622048-109622070 CCCCATTAAGAAGTGGGCAAAGG + Intergenic
1058926632 9:109670941-109670963 CCCCATTAAGAAGTGGGCAAAGG - Intronic
1060163787 9:121391508-121391530 TAACCTTAGTAACTGGGCATTGG - Intergenic
1061568056 9:131457384-131457406 CCCCTGAAGGAACTGGACATTGG + Intronic
1188075296 X:25768461-25768483 ATCCCTTAGGAACTGAGCCTGGG + Intergenic
1188935230 X:36167465-36167487 CCACCTTACGAACTGGGCAAAGG + Intergenic
1191651597 X:63544243-63544265 CCCCATTAAAAACTGGGCAAAGG + Intergenic
1192476474 X:71448158-71448180 ACCCTTTAGGGACTGGGAATTGG + Intronic
1192762740 X:74111538-74111560 TCCCATTAAGAAGTGGGCATAGG + Intergenic
1193015356 X:76726143-76726165 CCCCATTAAAAACTGGGCAAGGG - Intergenic
1194258016 X:91658070-91658092 CCCCATTAAAAACTGGGCAAAGG - Intergenic
1194301332 X:92189887-92189909 CCCCATTAAGAATTGGGCAAAGG - Intronic
1195121060 X:101752917-101752939 CCCCATTAAAAACTGGGCAAAGG + Intergenic
1195434033 X:104822067-104822089 CCCCATCAGAAACTGGGCAAAGG - Intronic
1196510832 X:116510199-116510221 TCCCATTAGAAACTGGGCAAAGG - Intergenic
1197625519 X:128797900-128797922 CCCCATTAAGAAATGGGCAATGG + Intergenic
1197642581 X:128983353-128983375 CCCCATTAAAAACTGGGCAAAGG + Intergenic
1198362715 X:135911489-135911511 ACTCCCTAGAAACTGGGCATCGG + Intronic
1198658446 X:138940253-138940275 CCCCATTAGAAACTAGGCAGAGG - Intronic
1200039120 X:153353262-153353284 CTCCCTCAGGGACTGGGAATGGG + Intronic
1200576780 Y:4897570-4897592 CCCCATTAAAAACTGGGCAAAGG - Intergenic
1201384252 Y:13421043-13421065 CCCCATTAGAAAGTGGGCAAAGG + Intronic