ID: 929304173

View in Genome Browser
Species Human (GRCh38)
Location 2:40341058-40341080
Sequence ATGGAGTAGTAGAGAGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 742
Summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 682}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929304167_929304173 27 Left 929304167 2:40341008-40341030 CCATAGTGGAGAAAGCATTTGAA 0: 1
1: 0
2: 1
3: 30
4: 242
Right 929304173 2:40341058-40341080 ATGGAGTAGTAGAGAGAAGAGGG 0: 1
1: 0
2: 3
3: 56
4: 682

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929304173 Original CRISPR ATGGAGTAGTAGAGAGAAGA GGG Intronic
900318670 1:2071668-2071690 ATGGATTAGAAGAGAGGAGTTGG + Intronic
900614406 1:3558256-3558278 GTGGAGTGGGAGAGAGAGGAGGG - Intronic
902407935 1:16196477-16196499 ATGGTGTAGTATAGGGACGAAGG - Intergenic
903825975 1:26146040-26146062 ATGGAGGAGGAGGGAGATGAGGG - Intergenic
905005844 1:34709786-34709808 ACGGAATAGGAAAGAGAAGATGG + Intergenic
905500940 1:38435880-38435902 AAGGAGTAGTTGTGAGAAAAGGG + Intergenic
905600723 1:39248186-39248208 ATGTTTTAGTAGAAAGAAGACGG - Intronic
905705181 1:40050936-40050958 ATGGAGTATTATAGGGAACAAGG - Intronic
905893708 1:41532177-41532199 ATGGAGGACAAGAGAGATGAAGG + Intronic
906811162 1:48828251-48828273 AGACAGTAGAAGAGAGAAGACGG + Intronic
907306295 1:53514867-53514889 ATGGAGAAATAAAGACAAGAGGG + Intronic
907356170 1:53875876-53875898 ATTTAATAGCAGAGAGAAGAAGG - Intronic
907716800 1:56933625-56933647 AAGGGGAAGCAGAGAGAAGATGG - Intronic
908141895 1:61193613-61193635 TTGGAGTAGAAAAGAGATGAAGG + Intronic
908206538 1:61856082-61856104 ATGGTGTAGCAGAAAGAAGTGGG + Exonic
908247330 1:62238220-62238242 AGGGAGGAGTCCAGAGAAGAAGG + Exonic
908890274 1:68838921-68838943 TTGGAGAAGCACAGAGAAGAGGG + Intergenic
909514039 1:76487710-76487732 TTTGACAAGTAGAGAGAAGAAGG - Intronic
909865739 1:80667953-80667975 CTGGAGGAATAGAGATAAGATGG + Intergenic
909884619 1:80925368-80925390 GTGGAGATCTAGAGAGAAGATGG + Intergenic
910144585 1:84064892-84064914 ATGGAGGGAAAGAGAGAAGAGGG - Intergenic
910153946 1:84191666-84191688 AGGGACTACTAGAGAGGAGAGGG + Intronic
910495251 1:87819695-87819717 ATGGTGCAGGAAAGAGAAGAGGG + Intergenic
910724297 1:90322498-90322520 ATGGATTGGTAGAGAGAAGATGG + Intergenic
910726433 1:90344754-90344776 ATGGAGAGTGAGAGAGAAGAAGG - Intergenic
911369195 1:96976103-96976125 ATGGAGCAGGAGAGAGGAAATGG + Intergenic
911392075 1:97258109-97258131 ATGGATTAGGAGGGAGAGGAAGG + Intronic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
911737503 1:101353871-101353893 AAGGAGAGATAGAGAGAAGAAGG - Intergenic
911880998 1:103237739-103237761 ATGGAGTGAGAGAGAGAAGGGGG + Intergenic
912267251 1:108171089-108171111 AATGAAGAGTAGAGAGAAGAGGG - Intronic
913708772 1:121457020-121457042 ATGGGGTAGTAATGAGGAGAAGG + Intergenic
913964258 1:143362151-143362173 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
915011621 1:152692045-152692067 TTTGAGGAGTGGAGAGAAGAAGG + Intergenic
915019864 1:152768998-152769020 ATGGAATAGCAGAGAGGACACGG + Intronic
915498051 1:156295024-156295046 ATGGAGTAGTGGAGGGTTGAGGG + Intronic
915717820 1:157961193-157961215 ATGGAGTATTAGAGAAAAAGAGG + Intergenic
916181633 1:162088973-162088995 AAGGAGTGGAAGAGAGATGAAGG - Intronic
916580351 1:166101346-166101368 TTTGAGGAGTTGAGAGAAGAAGG + Intronic
916635425 1:166662749-166662771 ATGGAGTAGAAGATGGAAGAAGG - Intergenic
917285441 1:173417688-173417710 ATGGAGTAGTACTAAAAAGAGGG - Intergenic
917789692 1:178491652-178491674 ACAGAGTTGTAGAGTGAAGATGG - Intergenic
918322167 1:183374743-183374765 ATGGCTTCCTAGAGAGAAGATGG - Intronic
918768732 1:188523869-188523891 AAGGTGTAGTAGAAAGAAGAAGG + Intergenic
919142759 1:193593320-193593342 ATGGAGAAGGAGAAAGAAAAGGG - Intergenic
919196928 1:194298022-194298044 AAGGAGAAGAAGAGGGAAGAAGG + Intergenic
919198528 1:194320671-194320693 ATGGAGTAAGACAGAGAAGAAGG - Intergenic
919301145 1:195767990-195768012 AGGCAGTAGGAGAGAGAAAAAGG - Intergenic
919346541 1:196387161-196387183 ATATAGTAGTAGGTAGAAGATGG - Intronic
921384549 1:214555338-214555360 TTGGAGTAATGGAGAGAAGTGGG + Intergenic
921412475 1:214850513-214850535 ATGGAGGAGGGCAGAGAAGAAGG - Intergenic
921685995 1:218089789-218089811 ATGGTGGAGTGGAGAGAGGAGGG - Intergenic
922030955 1:221797667-221797689 ATGGAGTGGGAGAAAGAGGAAGG + Intergenic
922626694 1:227053395-227053417 TGGGAGGAGTAGGGAGAAGAAGG + Intronic
924761384 1:246990079-246990101 AGGGAGAAAGAGAGAGAAGAAGG + Intronic
1063548965 10:7010452-7010474 AGGAGGTAGTAGAGAGGAGAAGG + Intergenic
1063664458 10:8053237-8053259 ATGGGGTAGAGGAGCGAAGAGGG + Intergenic
1063783093 10:9349502-9349524 AAGGAGCAAGAGAGAGAAGAGGG + Intergenic
1064229746 10:13519730-13519752 ATAGCGTAGCAGAGAGAAGTTGG - Intronic
1064299680 10:14112343-14112365 ATGGAGGAGCACAGAGGAGAGGG + Intronic
1064348859 10:14558095-14558117 ATGGAGTAGTCCAGGGAAGCAGG - Intronic
1064621895 10:17225807-17225829 ATGGAATGTTAGAAAGAAGAAGG - Intergenic
1064908541 10:20373657-20373679 ATGAAGTATTAGAGAAAATATGG - Intergenic
1064996285 10:21299576-21299598 GTGGAGTAGGAGAGAGAAACAGG - Intergenic
1065428818 10:25632856-25632878 ATGGAGTGGCAGTGAGGAGACGG - Intergenic
1065550435 10:26863883-26863905 AAGGAGGAGAAGGGAGAAGAAGG + Intergenic
1065761582 10:28987805-28987827 AAGGAGAAGTAGGAAGAAGAAGG - Intergenic
1066738495 10:38499820-38499842 ATGGAGTAGAATGGAGAAGAAGG + Intergenic
1067793692 10:49305930-49305952 ATGGAGCAGTACATATAAGAAGG + Intronic
1068175579 10:53453096-53453118 ATGAAGCAGTAAGGAGAAGATGG + Intergenic
1068214779 10:53969006-53969028 TTTGAGGAGTTGAGAGAAGAAGG + Intronic
1068281399 10:54875332-54875354 ATGGGGAAGAAGAGAGAAGGAGG - Intronic
1068757499 10:60671246-60671268 ATGTAGTAGAAAAGAGAGGATGG - Intronic
1069066704 10:63949629-63949651 TTTGATTAGTTGAGAGAAGAAGG - Intergenic
1069264771 10:66443831-66443853 ATTGATGAGTTGAGAGAAGAAGG + Intronic
1069298473 10:66877101-66877123 ATGAAGTAGGAGTGAGAGGAGGG - Intronic
1070516435 10:77212436-77212458 ATGGACTACTAGAGAGGGGAGGG + Intronic
1070605876 10:77898304-77898326 TTGGAGAAGGAGAGAGAAAAAGG + Intronic
1071247962 10:83786043-83786065 TTTGACTAGTTGAGAGAAGAAGG - Intergenic
1071263919 10:83946704-83946726 ATGGACTAGCAGAGACAAGGGGG - Intergenic
1071371070 10:84952400-84952422 ATGGGGTGGTGGAGAGAGGAGGG + Intergenic
1071386586 10:85126889-85126911 ATTGACGAGTTGAGAGAAGAAGG + Intergenic
1071400511 10:85264388-85264410 ATGCAAAAGTAGAGAGAATAGGG - Intergenic
1073515409 10:104071388-104071410 AAGGAGTAGAAGAAAGAACATGG - Intronic
1073689160 10:105788127-105788149 AAGGAGAAGGAGATAGAAGAAGG - Intergenic
1074007573 10:109443691-109443713 ATAGAGGAGTAGAAAGAAGTAGG + Intergenic
1074249873 10:111734282-111734304 ATGGCGTGGCAGAGAAAAGAAGG - Intergenic
1074260183 10:111845801-111845823 AGGGAGTAGGAGAGAGGAGGAGG + Intergenic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1075980742 10:126737030-126737052 AAGGAGCAGCAGAGAGAAGGAGG - Intergenic
1076130471 10:128010476-128010498 AGGAAGTAGGAGAGAGAAAAAGG - Intronic
1076419411 10:130319356-130319378 TTTGAGGAGTTGAGAGAAGAAGG - Intergenic
1077629327 11:3800122-3800144 ATGGAGGAGTTGGGGGAAGATGG - Intronic
1078047267 11:7926537-7926559 AAGGAGTAGTGAAGAAAAGAAGG + Intergenic
1078820216 11:14872497-14872519 AGGGAGTGGTAGAGAGATGGTGG + Intergenic
1079208074 11:18434947-18434969 AAGCACTAGTAGAGATAAGAAGG - Intronic
1079213502 11:18485230-18485252 ATTTAATGGTAGAGAGAAGATGG - Intronic
1080043971 11:27789090-27789112 ATGGAATAGGTGAGAGAAAATGG - Intergenic
1080067823 11:28040445-28040467 ATAGAGTAGAAGTGATAAGAAGG + Intronic
1080417913 11:32086804-32086826 AGAGAGTACTGGAGAGAAGATGG - Intronic
1081151476 11:39638398-39638420 AAGGAGTAGCAAAGGGAAGATGG + Intergenic
1082124372 11:48415059-48415081 TTTGACTAGTTGAGAGAAGAAGG - Intergenic
1082134555 11:48532891-48532913 ATTGATGAGTTGAGAGAAGAAGG - Intergenic
1082596271 11:55085527-55085549 ATTGACGAGTTGAGAGAAGAAGG + Intergenic
1082653875 11:55828223-55828245 GTGTTGGAGTAGAGAGAAGAAGG + Intergenic
1083489201 11:63002648-63002670 GTGGAGTAGGAGAGGGAGGAAGG - Intronic
1084472853 11:69373322-69373344 ATGGAGGAGGCAAGAGAAGAAGG + Intergenic
1085096652 11:73766261-73766283 AGGGAGTAGTAAACAGAAAAAGG - Intergenic
1085916848 11:80900461-80900483 ATGGAGTTGCAGAGAGAGCAGGG + Intergenic
1086246794 11:84762599-84762621 AAGAAGTAGAAGAGAGAAAAAGG - Intronic
1086529091 11:87763373-87763395 TTTGATTAGTTGAGAGAAGAAGG - Intergenic
1086673554 11:89575751-89575773 ATGAAGTAGAAGAAAGAAGAAGG - Intergenic
1086783176 11:90932110-90932132 AGGTAGTGGTGGAGAGAAGATGG - Intergenic
1086832794 11:91586162-91586184 ATGGAGCTGTAAAGAGAAAAGGG + Intergenic
1087147406 11:94825741-94825763 ATGGAGTAATAGAAAGAAGAAGG + Intronic
1087306867 11:96499361-96499383 CTGGAGAAGAAGAGAGAACAAGG - Intronic
1089900876 11:121983041-121983063 TTGGAGTATAAGATAGAAGAAGG + Intergenic
1090322403 11:125858491-125858513 TTTGACAAGTAGAGAGAAGAAGG + Intergenic
1090718212 11:129449352-129449374 ATGGAGTAATGGAGAGAAGCAGG + Intronic
1091449929 12:566018-566040 GTGGTGTAGTAGTGAGAGGATGG + Exonic
1091471378 12:731058-731080 ATGCAGAAGTAGAGAGCAGCTGG + Intergenic
1092028215 12:5261057-5261079 AAGCAGAAGTGGAGAGAAGAGGG + Intergenic
1092390841 12:8077257-8077279 ATGGTGTAGTAGGGGGATGATGG + Intergenic
1092743828 12:11654653-11654675 AGGGAGGAGATGAGAGAAGAAGG + Intronic
1092804664 12:12208966-12208988 ATGCATTAATAGAGAAAAGATGG - Intronic
1092951840 12:13510911-13510933 TTTGTGTAGTAGAGAGGAGAGGG + Intergenic
1093535562 12:20218858-20218880 ATGGAGGGGTAGGGAGATGAGGG - Intergenic
1093604627 12:21074669-21074691 AGGGAATAGGAGAGAGAAGATGG + Intronic
1093717613 12:22401238-22401260 ATTGACGAGTTGAGAGAAGAAGG + Intronic
1093802423 12:23389800-23389822 ATTGACAAGTTGAGAGAAGAAGG + Intergenic
1094034108 12:26048394-26048416 CTGGAGTGGTAGAGAGGAGGGGG + Intronic
1094188001 12:27665359-27665381 ATAGAGGAGGAGAGTGAAGAAGG + Intronic
1094474964 12:30833765-30833787 GTGGAGAAGGAGAGAAAAGAAGG + Intergenic
1095328910 12:40933101-40933123 AGGGAGAAGGAAAGAGAAGAAGG - Intronic
1095351893 12:41223370-41223392 AGGGAGGAGTAGAGAAGAGAAGG - Intronic
1095867940 12:46992956-46992978 TTTGATTAGTTGAGAGAAGAAGG + Intergenic
1096038745 12:48495527-48495549 ATGGAGCAGGAGAGTGAAAAGGG - Intronic
1097147344 12:56950888-56950910 ATGGATTTGAAGAGAGAAGTTGG - Intergenic
1097177366 12:57151204-57151226 ATGGAGAAGTTGAGAAAAGCTGG + Intronic
1097203532 12:57300445-57300467 ATGGGGTTGAAGAGAGAAGAGGG - Intronic
1097409630 12:59235457-59235479 ATGGAGAGGTAGGGTGAAGAGGG - Intergenic
1097929022 12:65163975-65163997 ATGGTATAGTAGAAAGAACAAGG + Intergenic
1098892038 12:76019056-76019078 GAGGAGAAGGAGAGAGAAGAGGG + Intergenic
1099048762 12:77757423-77757445 TTGTAGAATTAGAGAGAAGAAGG - Intergenic
1099539850 12:83894235-83894257 ATAGAGAAAGAGAGAGAAGAGGG - Intergenic
1099604421 12:84784127-84784149 AGAGAGAAGGAGAGAGAAGAAGG + Intergenic
1099732619 12:86525262-86525284 AGGCAGTAGGAGAGAGAGGATGG - Intronic
1100480894 12:94977882-94977904 ATGGAGTATGAGAGGGAACAGGG + Intronic
1100678992 12:96898413-96898435 ATGGCTTGGCAGAGAGAAGATGG + Intergenic
1100690723 12:97036084-97036106 CTGGTGTAGTAAAAAGAAGATGG - Intergenic
1101177678 12:102172290-102172312 GTGGGGAAGTAGAGAGAAGGAGG - Intronic
1101453449 12:104804375-104804397 ATGCATTTGTAGAGACAAGACGG - Exonic
1101903063 12:108805948-108805970 AGGGAGCAGAAGAGAGAACAAGG + Intronic
1102823069 12:115924452-115924474 AAGGAGGAGGAGGGAGAAGAAGG + Intergenic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1104096596 12:125563784-125563806 AAGGAGAAATACAGAGAAGAAGG + Intronic
1104608435 12:130206739-130206761 AGGGCGTAATAGAGAGAGGAAGG + Intergenic
1104667554 12:130658053-130658075 ACGGAGTCGTGGAGAGAGGATGG - Intronic
1105254269 13:18730894-18730916 AGGGAGTAAGAGAGAGAAGGGGG + Intergenic
1105471170 13:20696065-20696087 AAGGAGTGGAAGAGAGAATAGGG + Intergenic
1106157019 13:27168973-27168995 GTGGAATGGTGGAGAGAAGATGG - Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106900583 13:34351269-34351291 ATGGATGAGTAGAGGGATGATGG + Intergenic
1106979919 13:35267107-35267129 GTGGAGGAGAAGAAAGAAGAGGG + Intronic
1107347826 13:39481900-39481922 CTGGAGCAGTAGAGAGATGATGG + Intronic
1107448066 13:40485714-40485736 GAGGAGGTGTAGAGAGAAGAAGG - Intergenic
1107645024 13:42485278-42485300 ATGTATTATTACAGAGAAGAAGG - Intergenic
1107950455 13:45456838-45456860 TTGGAGGTGGAGAGAGAAGATGG + Intergenic
1108063170 13:46553066-46553088 AAGGAGGAGGAGAGAGCAGACGG + Intergenic
1108164858 13:47681835-47681857 ATGGTGAAGTAGACAGAGGAGGG + Intergenic
1108368530 13:49743273-49743295 ATGGAGCAATAGAGAGAGCAAGG + Intronic
1109434534 13:62282795-62282817 AGGGAGCAATAGAGAGAAGGGGG + Intergenic
1109966549 13:69706251-69706273 AAGAAGGAGTAGAGAAAAGAAGG - Intronic
1110080267 13:71300741-71300763 ATGGGATAGCAGAGAGAAGAAGG - Intergenic
1110164491 13:72423058-72423080 TTGGAGTAGGAAAGAGAAGATGG - Intergenic
1111162754 13:84417403-84417425 ATGAAGTTGGAGAGAGAAGCTGG + Intergenic
1111293891 13:86255599-86255621 ATGGGAAAGTAGAGAGAGGAAGG - Intergenic
1111375042 13:87367721-87367743 ATTGATGAGTTGAGAGAAGACGG - Intergenic
1111506152 13:89191600-89191622 AAGGAGAAATAAAGAGAAGATGG + Intergenic
1111659286 13:91189498-91189520 ATGGAGTAACAGAGAGAGAAAGG + Intergenic
1111863469 13:93738657-93738679 TTGGAGTAGGAGAGAGAGGAGGG + Intronic
1112155299 13:96810319-96810341 AAGGGGTAGAAGAGAGAAGAAGG + Intronic
1112748342 13:102553073-102553095 ATGGTCCAGCAGAGAGAAGACGG - Intergenic
1113203215 13:107889234-107889256 AAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1113516039 13:110899729-110899751 AAAGAATAGTAGAGAGAAAATGG - Intronic
1114616485 14:24071454-24071476 ATGGATTGGGAGGGAGAAGAGGG - Intronic
1114765773 14:25369524-25369546 TTTGAGGAGTTGAGAGAAGAAGG - Intergenic
1114801032 14:25776302-25776324 TTTGACTAGTTGAGAGAAGAAGG - Intergenic
1115135119 14:30098558-30098580 TTTGAGTAGTTGAGAGAAGTAGG + Intronic
1116808391 14:49515770-49515792 ATGGAGTGGGAGAGAGAGGAGGG + Intergenic
1117036670 14:51737237-51737259 AGGGAGTATTAAAGAAAAGAGGG + Intergenic
1117080153 14:52143425-52143447 ATGGAGTGGAAGAGATGAGAGGG - Intergenic
1117102692 14:52366574-52366596 ATGGAGTAATAGAGAGGAACTGG + Intergenic
1117206476 14:53448857-53448879 ATGGAGGAGAAGAGAGCTGAGGG + Intergenic
1117245981 14:53887119-53887141 TTGGATAAGTACAGAGAAGAGGG + Intergenic
1117265622 14:54083513-54083535 ATGGAATAGAGAAGAGAAGAAGG + Intergenic
1117359348 14:54958099-54958121 ATGGAGGAGGCGAGAGAAAATGG - Intronic
1117707709 14:58488978-58489000 ATGGTATAGTAGAAAGAATAGGG + Intronic
1117903511 14:60560502-60560524 ATGCAGTAATAGAGATGAGAAGG - Intergenic
1118048995 14:62005436-62005458 ACTGAGAAGTACAGAGAAGAAGG - Intronic
1118071368 14:62249878-62249900 ATGAAGTCACAGAGAGAAGATGG - Intergenic
1118121359 14:62847726-62847748 ATGGAGTAATAGAACGAATATGG - Intronic
1118500882 14:66361597-66361619 GTGGATTAGGAGAGAGAGGAAGG - Intergenic
1119439835 14:74620665-74620687 CTGGAGTAGTAGGAAGAACAAGG + Intergenic
1120160389 14:81139303-81139325 ATGAAGTAGAACAGAGACGAAGG - Intronic
1120599719 14:86487103-86487125 AAGGAGGAGAAGAGAGGAGAAGG + Intergenic
1120733425 14:88027632-88027654 AGGGAGTAGAATAGAGAAAAAGG + Intergenic
1121379883 14:93455337-93455359 ATGGAGATGTGGAGAGAACAAGG - Intronic
1121564130 14:94895977-94895999 ATGGAGTTGCAGAGAGAGGCAGG + Intergenic
1121929264 14:97957548-97957570 ATGGAAGAGAAGAGAAAAGAAGG - Intronic
1122038161 14:98963298-98963320 AAGGAGAAGGAGAAAGAAGAAGG + Intergenic
1122254207 14:100464715-100464737 ATGGAGTAGGGGAGATGAGATGG - Intronic
1122254218 14:100464833-100464855 ATGGGGTAGGAAAGAGTAGATGG - Intronic
1122254222 14:100464852-100464874 ATGGGGTAGGGGAGAGTAGATGG - Intronic
1122254241 14:100464947-100464969 ATGGGGTAGGGGAGAGGAGATGG - Intronic
1122532690 14:102439859-102439881 ATGGAGGAGGAGAGAGGAAAGGG - Intronic
1122685066 14:103500120-103500142 ATGTAGAAGCAGAGAGAAGAGGG - Intronic
1122820150 14:104338984-104339006 ATGGAGTATTAGCAATAAGAAGG - Intergenic
1123826872 15:24091492-24091514 AAGGAGGAATAGATAGAAGAGGG + Intergenic
1123841479 15:24252356-24252378 AAGGAGGAATAGATAGAAGAAGG + Intergenic
1123856261 15:24415323-24415345 AAGGAGGAATAGATAGAAGAGGG + Intergenic
1125542020 15:40475075-40475097 AGGTAGGGGTAGAGAGAAGAAGG + Intergenic
1126257948 15:46650297-46650319 TTGGAGCAGAAGAGAGTAGAGGG + Intergenic
1126402001 15:48281540-48281562 CTGAAGGAGAAGAGAGAAGAGGG + Intronic
1127157089 15:56139600-56139622 TTTGAGGAGCAGAGAGAAGAAGG - Intronic
1128045046 15:64610319-64610341 GTGGAGTAGAAAAGAGTAGAGGG + Intronic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128220540 15:65965253-65965275 CTGGAGGAGGAGAGAGAAAAGGG - Intronic
1129063455 15:72880671-72880693 AGGGAGGAGAGGAGAGAAGAGGG + Intergenic
1129760325 15:78125433-78125455 ATGGGATAGGAGAGAGAAGAGGG - Intronic
1130106993 15:80936206-80936228 AGGGAGTAGGAGGGAGAAGTAGG + Intronic
1130233406 15:82113629-82113651 AGGGAGGAGGAGAGAGTAGAGGG - Intergenic
1130364576 15:83222669-83222691 TTTGAGAAGTTGAGAGAAGAAGG + Intergenic
1130667442 15:85881568-85881590 AAGGAGTAGTGGAAGGAAGAGGG - Intergenic
1130985812 15:88843692-88843714 ATGGGGTCCTAGAGGGAAGAGGG + Intronic
1131139818 15:89968096-89968118 AGGGAGAGGAAGAGAGAAGAAGG + Intergenic
1131233021 15:90673334-90673356 ATGATGTTGTAGAGAGAAAAAGG + Intergenic
1131673206 15:94644055-94644077 ATGGAATAGAATAGAGAACATGG + Intergenic
1133392770 16:5422830-5422852 AGGGAGGAGCAGAGAGAAGGAGG + Intergenic
1133849657 16:9490248-9490270 AGGGAGGAGGAGAGAGAAGGAGG + Intergenic
1133858825 16:9575010-9575032 AAGGAATATTAAAGAGAAGAAGG - Intergenic
1135020817 16:18961664-18961686 CTGGAGTTCTAGAGAGAGGATGG - Intergenic
1135066534 16:19314888-19314910 AAGGAGGAGGAGGGAGAAGAAGG + Intronic
1135124854 16:19800134-19800156 ATGGGAAAGTAGAGAGAGGAAGG + Intronic
1135655090 16:24241409-24241431 AAGGAGCAGTAGAGGGAAAAGGG + Intergenic
1135695265 16:24580763-24580785 ATGAAGTAGAACAGAAAAGAAGG - Intergenic
1137790600 16:51171603-51171625 ATGGTGTTCTAGAGAGAATATGG - Intergenic
1137924460 16:52526687-52526709 CAGGCGTAGTAGAGAGAAGAGGG + Intronic
1138564306 16:57821643-57821665 ATGTACCAGTAGAGATAAGAAGG - Intronic
1139105365 16:63820816-63820838 TTTGACTAGTTGAGAGAAGAAGG + Intergenic
1139298329 16:65922334-65922356 GTGGAGCAGTGGAGAGGAGAGGG - Intergenic
1139556884 16:67718119-67718141 ATGGAGCAATATAGAGAAGATGG - Intronic
1139640884 16:68290643-68290665 AAGGGGGAGTAGGGAGAAGAGGG - Intronic
1140357050 16:74315383-74315405 ATGGAGTAGAATAGGGAGGAGGG - Intergenic
1140727000 16:77822529-77822551 TTGGAGGAGGGGAGAGAAGAAGG + Intronic
1140981208 16:80111571-80111593 ATGGGGTAGAAGAGGGCAGAGGG - Intergenic
1141332735 16:83126959-83126981 ATGAAGGAGTAGAGGGAGGAGGG + Intronic
1141410784 16:83831573-83831595 AGGGAGGAGTGGAGAGAGGAGGG - Intergenic
1141527065 16:84618324-84618346 AAGGAGAAGGAGAGAGAAGAGGG - Intergenic
1143008261 17:3851290-3851312 ATGGAGAAGGTGAGGGAAGATGG - Intergenic
1143035131 17:3990770-3990792 AAGGAGTAGGAGGAAGAAGAAGG - Intergenic
1143369741 17:6431597-6431619 ATAGAGTAGCAGACAGAAGACGG + Intronic
1143737697 17:8924598-8924620 TTGGATTAATGGAGAGAAGACGG - Intronic
1143954500 17:10657863-10657885 AAGGAGGAGAAGGGAGAAGAGGG - Intergenic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144193492 17:12868195-12868217 ATGAAGACGCAGAGAGAAGATGG - Intronic
1144335184 17:14262283-14262305 ACGGAGTAGCCGAGGGAAGACGG - Intergenic
1145081439 17:19897714-19897736 ATGAAGAAATAGAGAGATGAAGG + Intergenic
1145691945 17:26751376-26751398 GGGGAGCAGGAGAGAGAAGAGGG - Intergenic
1145716714 17:27029740-27029762 TTTGATGAGTAGAGAGAAGAAGG + Intergenic
1147622693 17:41878367-41878389 ATGAGGTAGTAGGGAGCAGAGGG - Intronic
1148549098 17:48539596-48539618 ATGGAGGAGTAAGGGGAAGAGGG - Intergenic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1148794668 17:50191265-50191287 AGGGAGGATTAGCGAGAAGAGGG + Intronic
1149063724 17:52455436-52455458 ATGGAATAGTATAGAGAACCTGG + Intergenic
1149183827 17:53973763-53973785 ATGGAAAAGGAGAGAGAAGAGGG - Intergenic
1150305329 17:64079815-64079837 ATGGAGGAATAGAGAGTGGAGGG + Intronic
1150941777 17:69700628-69700650 TTTGAGGATTAGAGAGAAGAGGG + Intergenic
1151006583 17:70444454-70444476 ATGGGGTAGTAGAGAGGAGGAGG + Intergenic
1151784441 17:76268500-76268522 AGGGAGTAGTGGAGGGAGGAGGG + Intronic
1152417671 17:80173248-80173270 ATGGAGAGGCAGAGAGCAGAGGG - Intronic
1152462747 17:80449957-80449979 AGGGGGTAGTGGAGAGAAGGAGG - Intergenic
1153103619 18:1502289-1502311 ATGGAGTAGAAAAGAGAGAATGG + Intergenic
1153819072 18:8817332-8817354 GTGGAGGAGGAGAGAGCAGAGGG + Intronic
1153899766 18:9607407-9607429 ACCGAGTAGTAGAGACATGATGG + Intronic
1153971824 18:10234104-10234126 AGAGAGGAGTAGAGAGAAGGAGG + Intergenic
1154401469 18:14042578-14042600 TTTGACTAGTTGAGAGAAGAAGG - Intergenic
1154436753 18:14349712-14349734 AGGGAGTAAGAGAGAGAAGGGGG - Intergenic
1155343708 18:24838118-24838140 ATGGAGAGGAAGAGAGAAGGTGG + Intergenic
1155787985 18:29926116-29926138 ATGGAGTCTTAGAGGCAAGAGGG + Intergenic
1156519357 18:37708727-37708749 ATAGAGAAGTGGAGAGAGGAAGG - Intergenic
1156697485 18:39784378-39784400 ATGGGGTAGGAGAGTGGAGATGG - Intergenic
1156812214 18:41266437-41266459 AGGGAGTAGGAGAGAGAAGTGGG + Intergenic
1157242183 18:46020958-46020980 AGGAAGTAGTAGAGAGAATACGG + Intronic
1157337961 18:46755314-46755336 ATGGGGAAGTTTAGAGAAGAAGG + Intronic
1158317943 18:56232175-56232197 AAGGAAAAGAAGAGAGAAGAAGG + Intergenic
1158522086 18:58180030-58180052 GTGGAGGAATAGAGAGAATAGGG - Intronic
1158765945 18:60449537-60449559 AGGGAGTAAGAGAGAGAGGAAGG + Intergenic
1158991979 18:62878370-62878392 ATGAAGTAGCAGAGAGAGGGAGG - Intronic
1159030849 18:63229580-63229602 AAGGAGTAAGAGAGAGGAGACGG - Intronic
1159425937 18:68286310-68286332 ACGCGGTAGTAGAGAGAAGTCGG + Intergenic
1160136699 18:76277882-76277904 ACGGAGCAGTAGAGAGATGGGGG - Intergenic
1161329093 19:3677968-3677990 ATGGAGGAATAGAGGGAAGGAGG + Intronic
1163779788 19:19240173-19240195 AGGGAGAAGGAGAGAGATGAGGG - Intronic
1164537991 19:29100658-29100680 AGGGAGAAGCTGAGAGAAGATGG - Intergenic
1164675993 19:30101933-30101955 ATGGAGCAAGAGAGAGAAGGCGG + Intergenic
1164742275 19:30584584-30584606 ATGGATTGGCAGAGAGAAGCTGG - Intronic
1165395809 19:35563071-35563093 ATGGAGAAATAGAGAGAGGGAGG - Intronic
1166002951 19:39889188-39889210 ATGGAGTGGGAGGGAGGAGAGGG + Intronic
1166005738 19:39905440-39905462 ATGGAGTGGGAGGGAGGAGAGGG + Intronic
1166670245 19:44705544-44705566 ATGGGGCAGTAGAGGGAAGGAGG - Intronic
1167197643 19:48041710-48041732 ATGGAGGAGGAGAGAGAGAATGG - Intronic
1167873816 19:52395266-52395288 GTGGAATAGTAGTGATAAGAGGG + Intergenic
1167890751 19:52537237-52537259 GAGGAGTAATAGAGGGAAGAAGG + Intronic
1202698029 1_KI270712v1_random:139642-139664 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
925594463 2:5541594-5541616 ATGGAGTAGAAGAAATAAAAAGG + Intergenic
925653430 2:6117479-6117501 AAGGAGTAGGAGAGAGCAAAGGG - Intergenic
925811601 2:7706594-7706616 ATTCAGTGGGAGAGAGAAGAAGG + Intergenic
925842588 2:8006566-8006588 ATGGAGGAGAAGAGAGAGGAGGG - Intergenic
925987696 2:9229710-9229732 ATGGAGTAGTTGATAGCAAAGGG + Intronic
926068317 2:9862100-9862122 ATTGACGAGTCGAGAGAAGAAGG + Intronic
926841430 2:17084950-17084972 ATGGAGAAGTAGATGGGAGATGG - Intergenic
927323004 2:21770333-21770355 TTGGTATAGTAGAGTGAAGAAGG - Intergenic
927499648 2:23574161-23574183 TTGGAGGAGGAGAGGGAAGAAGG + Intronic
929059087 2:37905011-37905033 ATGGAGTAGAAGAAAAAAGTAGG - Intergenic
929282443 2:40095696-40095718 AAGGCCTGGTAGAGAGAAGAGGG + Intergenic
929304173 2:40341058-40341080 ATGGAGTAGTAGAGAGAAGAGGG + Intronic
929881865 2:45843811-45843833 GAGGAGTAGGAGAGAAAAGAAGG - Intronic
929897034 2:45969580-45969602 GTGGAGAAGGGGAGAGAAGAGGG - Intronic
929898422 2:45981460-45981482 AAGCAGAAGGAGAGAGAAGATGG - Intronic
930148640 2:48034125-48034147 TCTGAGTGGTAGAGAGAAGAAGG - Intergenic
931491576 2:62753977-62753999 ATTGACAAGTTGAGAGAAGAAGG - Intronic
931895265 2:66721756-66721778 AAGGAGAAGAAGAGAGATGAGGG - Intergenic
932627971 2:73314076-73314098 GAGGAGTAGAAAAGAGAAGAGGG + Intergenic
932766782 2:74475455-74475477 ATGGAGTGTTTGGGAGAAGAGGG + Intronic
933089241 2:78099248-78099270 ATGAAGTGGTAGAGAAAACATGG + Intergenic
933579159 2:84105155-84105177 ATTGACGAGTTGAGAGAAGAAGG + Intergenic
933895118 2:86803905-86803927 TTGGAGTAGGAGAGAGGAAATGG + Intronic
934279283 2:91597422-91597444 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
934489232 2:94747827-94747849 AGGGAGTAAGAGAGAGAAGGGGG + Intergenic
934637242 2:96001353-96001375 TTTGAGGAGTTGAGAGAAGAAGG - Intergenic
934796410 2:97104054-97104076 TTTGAGGAGTTGAGAGAAGAAGG + Intergenic
934982280 2:98852927-98852949 AGGGAAAAGGAGAGAGAAGAAGG + Intronic
935140616 2:100349993-100350015 AAGGAGGAAGAGAGAGAAGAGGG - Intergenic
935862302 2:107346417-107346439 ATTGAATAGTAGAGACAAGGTGG + Intergenic
936242165 2:110797181-110797203 AGAGAGTAGGACAGAGAAGACGG + Intronic
936268893 2:111033181-111033203 ATGGAGGAGGAGCGAGGAGAGGG + Intronic
936752056 2:115655539-115655561 ATTGAGTAGGAAACAGAAGATGG - Intronic
936760826 2:115779588-115779610 ATGGAAGAGTAGAGAGAAAAAGG + Intronic
937064513 2:119007044-119007066 CTGGAGTAGTGGAAGGAAGAAGG - Intergenic
937514465 2:122637864-122637886 ATGGGGCAGTGGAGTGAAGAGGG + Intergenic
939893779 2:147767663-147767685 ATTGACGAGTTGAGAGAAGAAGG + Intergenic
940896877 2:159089449-159089471 ATTGAGAAGTAAAGAGAAGAGGG - Intronic
941014135 2:160335305-160335327 ATGGAGTAGCTGGGAGAAGGAGG + Intronic
941075640 2:161003313-161003335 TTTGACTAGTTGAGAGAAGAAGG + Intergenic
941649199 2:168075134-168075156 ATGGATGAGAAGAGCGAAGAAGG - Exonic
941723149 2:168833671-168833693 TTGGAGAAGTAGAAAGAAGTAGG - Intronic
941759669 2:169227967-169227989 GTGGAGCAGCTGAGAGAAGAAGG - Intronic
942276170 2:174325673-174325695 ATGTAGTAATAGAGAGAAAAAGG + Intergenic
942411854 2:175717726-175717748 ATTGAGAAGTTGAGAGAAGAAGG + Intergenic
942760076 2:179386907-179386929 TTTGACTAGTTGAGAGAAGAAGG + Intergenic
943605802 2:189975967-189975989 ACTGACTAGTTGAGAGAAGAGGG - Intronic
943617921 2:190115216-190115238 AAGGAGAAGTAGAAAGGAGAGGG + Intronic
944288013 2:197973910-197973932 GTGGAGGAGTAGAGAGAATAGGG + Intronic
944600818 2:201301079-201301101 ATTGACGAGTTGAGAGAAGAAGG + Intronic
945352798 2:208801792-208801814 TTTGACGAGTAGAGAGAAGAAGG + Intronic
945976897 2:216277923-216277945 TTGGAGCAGCAGACAGAAGAGGG - Intronic
946060157 2:216934500-216934522 AGGGAGTGGCAGAGAGAACATGG - Intergenic
946141778 2:217697363-217697385 AGGGAGAAGAAAAGAGAAGATGG - Intronic
946392911 2:219426996-219427018 AAGGTGTAGTAGAGAGCACAAGG - Intergenic
946406154 2:219493049-219493071 ATGGAGAAGTGGAGAGGAAAAGG + Exonic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
947746286 2:232508876-232508898 ATGGAGGCTCAGAGAGAAGAGGG - Intergenic
948684604 2:239662523-239662545 ATGGAGGAGCAGAGTGGAGAGGG - Intergenic
1169275174 20:4228877-4228899 CTGGAGACGTGGAGAGAAGAAGG - Intronic
1169982042 20:11395531-11395553 ATTGAGTGGTGGAGAGAAAAGGG - Intergenic
1170682808 20:18541586-18541608 AAGGAGGAGGAGAGAGATGAGGG + Intronic
1171140961 20:22742183-22742205 ATGGTCTAGTAAAGAAAAGAGGG - Intergenic
1172227040 20:33311966-33311988 ATAAAGGAGCAGAGAGAAGAAGG - Intergenic
1172292089 20:33783981-33784003 ATGGAGAAGTGGAGGGAAAAGGG - Intronic
1173762108 20:45571666-45571688 TTGTAGAAGTAGAGAGTAGATGG - Intronic
1174478098 20:50811531-50811553 ATGGAGTGGCAGGGAGAGGAGGG - Intronic
1174685994 20:52455692-52455714 AGGGAGCAAAAGAGAGAAGAGGG + Intergenic
1176840285 21:13835932-13835954 AGGGAGTAAGAGAGAGAAGGGGG + Intergenic
1177132251 21:17272448-17272470 ATTGACGAGTTGAGAGAAGAAGG + Intergenic
1177928351 21:27248196-27248218 GAGGAGGAGGAGAGAGAAGAAGG - Intergenic
1178147816 21:29759794-29759816 AGGGAGGAGTAGACAGCAGAGGG - Intronic
1178245581 21:30948479-30948501 AGGGAGTAGTAAAGAAAAGTTGG - Intergenic
1178268250 21:31165351-31165373 ATGTAATAGTAGTTAGAAGAGGG + Intronic
1179355307 21:40653296-40653318 TTGGAGCAGTAGAAAAAAGATGG + Intronic
1179673208 21:42964210-42964232 GTGGGGTAGGGGAGAGAAGAGGG - Intergenic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180323191 22:11342564-11342586 TTTGAGGAGTTGAGAGAAGAAGG + Intergenic
1180593163 22:16957557-16957579 ATGGAATGGAAGAGAGAGGAAGG + Intergenic
1181284262 22:21740729-21740751 ATGGAGGAGGAGAGAGAGGAAGG - Intergenic
1181342060 22:22188984-22189006 TTTGAGGAGTTGAGAGAAGAAGG + Intergenic
1181485576 22:23229739-23229761 ATGGGGAAGTAGAGAGTATAGGG - Intronic
1181497771 22:23297534-23297556 ATGGAGAGGGAGAGAGAAGTGGG - Intronic
1181570468 22:23765514-23765536 ATGCAGAGGTAGAGACAAGAAGG + Intronic
1181905528 22:26192207-26192229 ATGGATTAGTGGACAGATGAAGG - Intronic
1182804152 22:33056805-33056827 TTGGTGTAGTAGAAAGAACAAGG - Intronic
1183005945 22:34902267-34902289 ATGCATTATTAGAGAAAAGAGGG + Intergenic
1183105011 22:35609387-35609409 AGGGATTTGCAGAGAGAAGATGG + Intronic
1183272382 22:36870299-36870321 ATGCATTAGTAAAGAGAGGAGGG + Intronic
949367899 3:3302786-3302808 AGGCAGCAGGAGAGAGAAGAAGG - Intergenic
949645556 3:6089553-6089575 ATGGGGTAGTAGACAGTAGCAGG - Intergenic
949940177 3:9148724-9148746 ATGGGGTAGTGGAGAAAGGATGG - Intronic
950252184 3:11475080-11475102 ATAGAGGAGTAGAAATAAGAAGG + Intronic
950714956 3:14841514-14841536 ATGGATTACTGGAGAGAGGAAGG + Intronic
951493664 3:23301268-23301290 TTTGATTAGTTGAGAGAAGAAGG - Intronic
951586727 3:24222409-24222431 AGGTAGTAGTGGGGAGAAGAGGG + Intronic
953110989 3:39937951-39937973 AAGGAGGAGGAGAGAGAAGTAGG + Intronic
953551634 3:43907973-43907995 AGGGAATGGTAGAGGGAAGAGGG - Intergenic
954044203 3:47915539-47915561 ATCGAGTAGGAAAGAGGAGATGG + Intronic
955237124 3:57149383-57149405 ATGGGTAAGTACAGAGAAGAAGG - Intronic
955479211 3:59372309-59372331 ATTGAGCTGAAGAGAGAAGAGGG - Intergenic
956215483 3:66843940-66843962 TTTGAGGAGTTGAGAGAAGAAGG + Intergenic
956931949 3:74053463-74053485 CTGGAGTCATAGAGAGAAAATGG + Intergenic
956990285 3:74754845-74754867 ATGGAGTTATACAGAGGAGATGG - Intergenic
957553558 3:81736960-81736982 ATGGAGTAGTAGAAGCAGGAAGG + Intronic
957632858 3:82740560-82740582 ATGGAGAAGCAGAGAGGAGAGGG + Intergenic
958129190 3:89395820-89395842 ATGGAGCTGTAAAGAGAGGATGG - Exonic
958163665 3:89851424-89851446 ATGGAGTAGGGGAGAGGAGAAGG + Intergenic
958175881 3:89995970-89995992 ATGGAGGAGTGGAGCCAAGATGG + Intergenic
958686768 3:97408397-97408419 AGGGAGGAGAAGAGAAAAGAGGG - Intronic
959504807 3:107145237-107145259 TTTGACTAGTTGAGAGAAGAAGG + Intergenic
960547128 3:118928360-118928382 ATGGAGAAGGAGAGAAGAGATGG + Intronic
960744562 3:120872855-120872877 AGGCAGTAGGAGAAAGAAGAAGG + Intergenic
962012471 3:131405816-131405838 TTGGTTTATTAGAGAGAAGAGGG - Intergenic
963070376 3:141300523-141300545 TTTGACGAGTAGAGAGAAGAAGG - Intergenic
963926522 3:150957175-150957197 ATAGAGCAGTAGAGAGGAAAAGG - Intronic
964001193 3:151774322-151774344 AGGGAGTGGTAGGTAGAAGAAGG + Intergenic
964248030 3:154676965-154676987 ATGGAGAAGTAGAAAGGAGCTGG - Intergenic
964500890 3:157347390-157347412 AGAGAGATGTAGAGAGAAGATGG + Intronic
964580349 3:158227428-158227450 ATGGAGGAAAAGAGAGATGAAGG - Intronic
964993046 3:162838625-162838647 ATTGAGTTATAGAGAGATGATGG - Intergenic
965079535 3:164019664-164019686 GTGGAGTGGTAGTGAGAAGGAGG + Intergenic
965172168 3:165279838-165279860 GAGGAGAAGAAGAGAGAAGAAGG - Intergenic
965264904 3:166531061-166531083 AAGGAGAATTAGAGTGAAGAGGG + Intergenic
965476935 3:169167614-169167636 ATGGAGGAGGAGTTAGAAGATGG - Intronic
965688631 3:171332078-171332100 TTGGAAAAGTATAGAGAAGACGG + Intronic
965835757 3:172850370-172850392 ATTGAGAAATGGAGAGAAGAAGG + Intergenic
966640810 3:182187637-182187659 ATGAAGTACCAGAGAGGAGAAGG - Intergenic
967292605 3:187935939-187935961 CGGGAGTAATAGTGAGAAGAGGG + Intergenic
967510598 3:190306797-190306819 ATAGACTGGTAGAGAGAGGAAGG + Exonic
967510605 3:190306865-190306887 ATAGACTGGTAGAGAGAGGAAGG + Exonic
967510612 3:190306933-190306955 ATAGACTGGTAGAGAGAGGAAGG + Exonic
968530199 4:1087212-1087234 ATGGGGTAGGGGAGAGAGGACGG + Intronic
969031472 4:4218471-4218493 ATGGAAAAGGAGAGGGAAGAAGG + Intronic
969191009 4:5519318-5519340 TTGGACGAGTTGAGAGAAGAAGG + Intergenic
969199933 4:5594727-5594749 TTGGACGAGTTGAGAGAAGAAGG + Intronic
969525443 4:7701793-7701815 ATGGAGGGGCAGAGGGAAGACGG + Intronic
969758208 4:9164021-9164043 ATGAAGTAGTATAGACATGAAGG - Intergenic
970368835 4:15387947-15387969 AGGGAGAAGAGGAGAGAAGATGG + Intronic
970972257 4:21997784-21997806 TTTGAGGAGTTGAGAGAAGAAGG + Intergenic
972040164 4:34584258-34584280 TTGGGGTAGTAGTGAGAAGGGGG - Intergenic
972305026 4:37822703-37822725 ATAGAATAGTAGATTGAAGAAGG - Intergenic
972651273 4:41019945-41019967 AAGGAGTCGAAGAGAGAGGAGGG + Intronic
973782017 4:54296988-54297010 ATGGAGTGGGAGGCAGAAGACGG - Exonic
973962683 4:56127522-56127544 AGGCAGAAGAAGAGAGAAGAAGG - Intergenic
974078490 4:57189637-57189659 ATGGCATAGAAGAGAGTAGAAGG - Intergenic
974179852 4:58370654-58370676 GTGGAGGAATAGAGAGAGGAAGG - Intergenic
974396616 4:61344493-61344515 AGGGAATAGTAGACAGAAGCAGG - Intronic
974511380 4:62846207-62846229 ATGGAGCATAAGAGAGAAAATGG + Intergenic
974841307 4:67302680-67302702 ATGGAGGTGGAGAGAGAGGAAGG + Intergenic
974921002 4:68238798-68238820 ATAAAATAGTAGAAAGAAGAGGG - Intronic
975259970 4:72286934-72286956 ATGGAGGAGTAGAGAAAAAGAGG + Intronic
975366335 4:73533281-73533303 ATGGTTTAGAAGAAAGAAGAGGG - Intergenic
975380556 4:73695905-73695927 TTGGAGTAATAGAGAGTAGAAGG + Intergenic
976078789 4:81330803-81330825 ATGGCATAGTGGAGAGAAGGTGG + Intergenic
976428686 4:84936927-84936949 ATGACGTAGGAGAGAGAAGTGGG - Intronic
976714806 4:88112419-88112441 AGAGAGAAGTAGGGAGAAGAAGG - Intronic
976794154 4:88913415-88913437 AAGTAGTAGTAGAGGGAAGAGGG + Intronic
977468114 4:97407379-97407401 AAGCAGTAGGAGAAAGAAGAAGG - Intronic
977851674 4:101837925-101837947 AGGGAGAGGGAGAGAGAAGAGGG - Intronic
978004722 4:103602369-103602391 TTAGAGGAGTTGAGAGAAGAAGG - Intronic
978486818 4:109263737-109263759 AGTAAGTAGTAGAGAGCAGAGGG - Intronic
979177729 4:117685134-117685156 ATTGATGAGTTGAGAGAAGAAGG - Intergenic
979432588 4:120648813-120648835 TTGGAATAGTAGAGATAAGGAGG - Intergenic
979585526 4:122410980-122411002 GTGGAGTAGTAGAGAAAGGATGG + Intronic
979805814 4:124969638-124969660 GTGGACTACTAGAGAGAAGAGGG - Intergenic
979932068 4:126643210-126643232 ATGGAGGAGCAGAGGGATGAGGG + Intergenic
980771726 4:137381783-137381805 CTGGAATAGTATAGAAAAGAGGG - Intergenic
980994437 4:139766661-139766683 TTGGAGTTGTCGGGAGAAGAAGG - Intronic
981590651 4:146356596-146356618 AAGAAGTAGAGGAGAGAAGATGG - Intronic
981730021 4:147887329-147887351 CTGGAGCAGTGGAGAGAAGATGG - Intronic
983163788 4:164450127-164450149 ATGGAGAAATAGAGAGAAAGAGG + Intergenic
983727839 4:170951808-170951830 TTAAAGTAGTAGAGAGGAGATGG - Intergenic
984448643 4:179870503-179870525 ATGAAAAAGTAGAGAGAAAAAGG - Intergenic
984752108 4:183288100-183288122 ATGCATTTGTAGAGAGGAGAGGG + Intronic
985237498 4:187892012-187892034 ATGGATAAGTAGACAGAGGAAGG + Intergenic
985897311 5:2756417-2756439 AAGGAGGAGGAGAGAGAAAAGGG - Intergenic
985987592 5:3529689-3529711 AGGGAGAAGGAGAGAAAAGAGGG - Intergenic
986470375 5:8067830-8067852 ATGAAGTAGGAGAGAAAGGAGGG + Intergenic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987542023 5:19268400-19268422 ATGGAGGTGTAGACACAAGATGG + Intergenic
987682711 5:21158756-21158778 ATGGAGTTGGAGAGAGAAATGGG + Intergenic
988683761 5:33507870-33507892 ATGTAGAAGAAGAGAGAAGGAGG - Intergenic
989238896 5:39180760-39180782 CTGGAGAAGTAGAAAGTAGATGG - Intronic
989968084 5:50488968-50488990 TTTGACGAGTAGAGAGAAGAGGG - Intergenic
989969324 5:50503515-50503537 ATGGGGTAGTAATGAGGAGAAGG - Intergenic
990384593 5:55247463-55247485 AAGGAGTAGTAGTGGGAAGTGGG + Intergenic
990662776 5:58036584-58036606 ATGGAGCAGAATAGAGAATATGG + Intergenic
990831891 5:59968416-59968438 ATGGACTACTAGAGGGTAGAGGG + Intronic
990965941 5:61447929-61447951 AGGGAGGAGTAAAGAGAAGTTGG + Intronic
991217546 5:64172778-64172800 ATGGAGCACTTGAGAGAAGTAGG + Intronic
991258500 5:64641571-64641593 ATGGAATAGTACAGGGAACAAGG + Intergenic
991365722 5:65866067-65866089 ATGGGGAAGAAGACAGAAGAGGG + Intronic
992277757 5:75138493-75138515 AAGGAGGAGAAAAGAGAAGAAGG + Intronic
992787523 5:80184241-80184263 ATGGAGTAGAAGAGAGAAGGTGG - Intronic
993001484 5:82385704-82385726 AGAGAGAAGCAGAGAGAAGAGGG - Intronic
993444237 5:87991605-87991627 ATTGATGAGTTGAGAGAAGAAGG + Intergenic
993516806 5:88846701-88846723 ATGCAGTAGAAAAAAGAAGAAGG - Intronic
993882040 5:93374419-93374441 AGGGAGTAAGAGAGAGAAGGAGG - Intergenic
993900824 5:93583473-93583495 ATGGAGTAAAAGAGACAAGGAGG - Exonic
994112842 5:96026321-96026343 ATGGACTAATAAAGAGGAGAAGG + Intergenic
994224721 5:97239252-97239274 TTTGATGAGTAGAGAGAAGAAGG - Intergenic
994457655 5:100033022-100033044 ATGGAATAGTATAGAGAACCTGG + Intergenic
994664165 5:102688410-102688432 TTTGACAAGTAGAGAGAAGAAGG - Intergenic
995679537 5:114701502-114701524 ATGGGGTAGAAGAGGGAAGGTGG - Intergenic
996272619 5:121625193-121625215 ATGCAGACTTAGAGAGAAGAGGG + Intergenic
996672291 5:126132798-126132820 ATGGGGTAGTACATAGAAGTAGG + Intergenic
996816228 5:127575533-127575555 ATAGGGTAGGAGAGAGTAGAAGG + Intergenic
997174446 5:131760076-131760098 GTGGACTACTAGAGGGAAGAGGG + Intronic
997178949 5:131808171-131808193 AGGGAGGAGTAGAGAGTAGTAGG - Intronic
997667781 5:135645912-135645934 AGGGAGGAGTAAAGAGAATAGGG + Intergenic
997849086 5:137314766-137314788 GTGGAGGAGTAAAGAGAACATGG - Intronic
997893957 5:137699327-137699349 ATGGAGTAACAGTGAGAAGAAGG + Intronic
998399782 5:141842660-141842682 CCAGAGAAGTAGAGAGAAGAGGG + Intergenic
998503635 5:142654693-142654715 ATGGAGTCGAAGACAGCAGATGG - Intronic
998664788 5:144284251-144284273 ATGGACTACTAGTGAGAAAAGGG + Intronic
999021979 5:148176101-148176123 ATGAAGTATAAGAGAGAAAAAGG - Intergenic
999031638 5:148299645-148299667 ATTGTGTAGTAAAGAGAATACGG - Intergenic
999261489 5:150241435-150241457 ACGGAGTAAAAGAGAGAGGAGGG - Intronic
999506307 5:152201022-152201044 ATGGAGTGGTAGAAAGCATATGG + Intergenic
1000102187 5:158026623-158026645 ATGGAGCAGGAGGGAGAAGAGGG - Intergenic
1000681940 5:164196045-164196067 CTGAAGAGGTAGAGAGAAGATGG - Intergenic
1000686469 5:164255691-164255713 ATGGGGTAGTAGAGATAAAAGGG - Intergenic
1000696586 5:164393334-164393356 ATGCAGTAGTCGGGTGAAGAAGG + Intergenic
1000912934 5:167044211-167044233 ATGGTGTATTAGAGAGAATCTGG + Intergenic
1000913057 5:167045500-167045522 AAGGTGAAGGAGAGAGAAGAGGG - Intergenic
1001498656 5:172210381-172210403 ATGGAAAAGTACAGACAAGAAGG - Exonic
1001649565 5:173305820-173305842 ATGGTGTAGCAGTGAGAAAAAGG + Intergenic
1002696109 5:181092274-181092296 ATGGAGAAGGAGATAGACGAGGG + Intergenic
1003758057 6:9144658-9144680 ATGGACCAGAAGAGAGAATATGG - Intergenic
1003803544 6:9699785-9699807 ATGGAGTAGCAGAAAGACCACGG - Intronic
1003898369 6:10629561-10629583 TGGGAGTGATAGAGAGAAGAGGG + Intergenic
1004423254 6:15489871-15489893 AAGGAGGAGGAGAGGGAAGAGGG - Intronic
1004827602 6:19440390-19440412 ATGGTGTAGTGGAAAGAACATGG - Intergenic
1005049639 6:21673075-21673097 AAGGAGGAATAGAGAGTAGAAGG + Intergenic
1005992701 6:30913470-30913492 ATGGACTAGGAGAGAAAAGCTGG + Intronic
1006388860 6:33747053-33747075 AAAGAGGAGGAGAGAGAAGAGGG + Intergenic
1006521205 6:34572258-34572280 ATGGAGCAGTGCAGAGGAGACGG - Intergenic
1007180161 6:39923756-39923778 ATGGGGCAGGAGGGAGAAGAGGG + Intronic
1008043659 6:46829660-46829682 AAGGAGGAGGAGAGAGAAGAAGG - Intronic
1008447398 6:51609233-51609255 AGGGAGCAGAAAAGAGAAGAAGG - Intergenic
1008671670 6:53775171-53775193 TTTGACTAGTTGAGAGAAGAAGG + Intergenic
1009291324 6:61886382-61886404 ATTTAGAAGCAGAGAGAAGAGGG - Intronic
1009382892 6:63054057-63054079 TTTGACTAGTTGAGAGAAGAAGG + Intergenic
1009864668 6:69382092-69382114 ATGGTGAAGTTGAGAGAAAAGGG + Intronic
1010508585 6:76689678-76689700 AGGGAGCAAGAGAGAGAAGAAGG - Intergenic
1011295012 6:85817081-85817103 TTTGAGGAGTTGAGAGAAGAAGG + Intergenic
1011296699 6:85834360-85834382 TTTGAGGAGTTGAGAGAAGAAGG - Intergenic
1011371313 6:86639827-86639849 AAGAAGGAGGAGAGAGAAGATGG + Intergenic
1011380018 6:86732539-86732561 ATTGACGAGTTGAGAGAAGAAGG + Intergenic
1012222328 6:96664109-96664131 ATGGAATACTAGAGAAGAGAGGG + Intergenic
1012629774 6:101450766-101450788 ATAGAGAAGTAAAGAAAAGAAGG + Intronic
1014331487 6:120071209-120071231 ATGGAGTAGGAGAAGCAAGATGG - Intergenic
1014423055 6:121268260-121268282 ATTGATGAGTTGAGAGAAGAAGG + Intronic
1015051825 6:128850281-128850303 CTGGAGTAGTCGAGAGGAGGAGG - Intergenic
1015081143 6:129227315-129227337 TTTGAGGAGTTGAGAGAAGAAGG - Intronic
1017074992 6:150609750-150609772 ATGCAGTGGTACAGAGAAGGAGG + Intronic
1017192102 6:151665568-151665590 GTGGAGTGGTGGAGAGAAAAGGG - Intronic
1018248336 6:161843297-161843319 ATGGAGAAGGAGACAGAAGGTGG - Intronic
1018463033 6:164017205-164017227 ATGGAGAAATAGAGGGACGAGGG - Intergenic
1018525649 6:164707737-164707759 TTTGAGGAGTTGAGAGAAGAAGG - Intergenic
1018788516 6:167128012-167128034 CTGGAGTTGCAGACAGAAGAGGG - Intronic
1020011459 7:4807889-4807911 AGGGAGAAGAAGAGGGAAGAGGG - Intronic
1021281898 7:18730224-18730246 GTGGAATAGCAGAGTGAAGATGG - Intronic
1021943044 7:25698526-25698548 AACCAGTAGTAGAGGGAAGAAGG + Intergenic
1022094315 7:27129629-27129651 AAGGAGGAGGAGAGAGAAGGTGG + Intronic
1022108832 7:27215376-27215398 AAGGAGGAGGAGAGTGAAGAAGG - Intergenic
1022267637 7:28772810-28772832 ATGCAGTAGATGAGAGAAGGAGG - Intronic
1022574812 7:31487349-31487371 ATGGTGAAGGAGAGAGCAGAAGG - Intergenic
1022892137 7:34712307-34712329 ATGGAAAAGTAGAGTGGAGAAGG - Intronic
1022934011 7:35152957-35152979 TTTGAGGAGTTGAGAGAAGAAGG + Intergenic
1024731127 7:52254965-52254987 ATGGAGGGGTAGAAAGAAAAAGG + Intergenic
1025198727 7:56949491-56949513 AGGGAGGAGAAGAGAGGAGAAGG - Intergenic
1025557316 7:62324943-62324965 GGGGAGCAGGAGAGAGAAGAGGG + Intergenic
1025595054 7:62913842-62913864 TTTGACTAGTTGAGAGAAGAAGG - Intergenic
1025673221 7:63627440-63627462 AGGGAGGAGAAGAGAGGAGAAGG + Intergenic
1025874613 7:65469473-65469495 ATTGACAAGTTGAGAGAAGAAGG - Intergenic
1026164815 7:67900453-67900475 ACAGAGTAGAACAGAGAAGAGGG - Intergenic
1026361070 7:69600603-69600625 AGGGAGGAGGGGAGAGAAGAGGG + Intronic
1026418105 7:70203867-70203889 ATGTATTTGTAGAGAGAAGAAGG + Intronic
1026575131 7:71565451-71565473 ATGAAGTGCTAGAGAGAGGAAGG - Intronic
1027631614 7:80613063-80613085 AAGTAGTAGTAGAGAGAGGAGGG + Intronic
1027719664 7:81724277-81724299 ATAGAGTTGTAGAGGGAAGAGGG - Intronic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1027792473 7:82650996-82651018 TTTGACTAGTTGAGAGAAGAAGG + Intergenic
1029493615 7:100885405-100885427 ATGGAGAAGTGGAGGGTAGAGGG + Intronic
1029815211 7:103086890-103086912 ATGGAGAATAAGACAGAAGAGGG + Intronic
1030151114 7:106406102-106406124 AAGGAGTGGGAGAGAGATGAGGG + Intergenic
1030607684 7:111655362-111655384 AGGGAGGAAGAGAGAGAAGAGGG + Intergenic
1030799096 7:113827311-113827333 GAGGAGTAGAAGAGAGAAAATGG + Intergenic
1030883814 7:114914891-114914913 TCGAAGTAGGAGAGAGAAGAAGG + Intergenic
1030965690 7:115990381-115990403 TTTGAGGAGTTGAGAGAAGAAGG + Intronic
1031165927 7:118226636-118226658 ATGGAGGAGGAGGAAGAAGAGGG + Intronic
1031490612 7:122383320-122383342 GTGGACTAGTAGAGGGGAGAGGG + Intronic
1031757643 7:125665873-125665895 ATGAGGTAGTAGAGAGAAGGTGG + Intergenic
1031766714 7:125787266-125787288 ATGGAGGAGGAGTGAGAGGAAGG + Intergenic
1032519621 7:132534129-132534151 GTGTAGTAGTAAAGAGGAGAGGG + Intronic
1032605491 7:133346319-133346341 ATGGAGAAGCAGACAGAAGCAGG - Intronic
1032631922 7:133662805-133662827 AAGAAGCAGTAGATAGAAGATGG + Intronic
1033211895 7:139466101-139466123 GAGGAGTAGTAGATAGCAGATGG - Intronic
1033465536 7:141585962-141585984 ATGGTGTAGTGGAAAGAACATGG + Intronic
1033828317 7:145219699-145219721 AAGGAGCAGCAGAGAGAAGGGGG - Intergenic
1034605179 7:152306402-152306424 AGGGAGTGGGAGGGAGAAGAAGG - Intronic
1035341368 7:158164720-158164742 ATGGGATAGGAGAGAGAAAAGGG + Intronic
1036111415 8:5907151-5907173 ATGGAGGAATAGAGAGATGGAGG - Intergenic
1036473293 8:9070324-9070346 ATGGAGTAGTCTAAAGAAGCAGG + Intronic
1036556537 8:9864891-9864913 ATGGAGTAGAGCAGAGAGGAAGG - Intergenic
1036917364 8:12817075-12817097 TTTGTCTAGTAGAGAGAAGAAGG - Intergenic
1037004970 8:13767105-13767127 ATGGAGAATTAGAGAGAGGTGGG + Intergenic
1037286318 8:17304395-17304417 ATGGTGTTGTAGGGAGATGAAGG + Exonic
1037372522 8:18194983-18195005 ATGACGTATTAGTGAGAAGAGGG - Intronic
1037600696 8:20391497-20391519 ATGGAGTGGGAGAGGGAAGTGGG + Intergenic
1037866688 8:22449705-22449727 ACTAAGAAGTAGAGAGAAGATGG + Intronic
1038119356 8:24594841-24594863 ATAAAGTAGAAGAGAGAAGGTGG - Intergenic
1038670122 8:29576512-29576534 ATGGAAAGGTAGAGAGAAGTAGG - Intergenic
1039312391 8:36331225-36331247 AAGGAGTAATAGAAAGAATAGGG + Intergenic
1039685790 8:39801003-39801025 ATGGAGTAATTGACAGAAGATGG - Intronic
1040384229 8:46902760-46902782 ATGGGGTAGAGGAGAGAAGGAGG + Intergenic
1040821132 8:51558978-51559000 ATGGATTAGTAGAGGGAAAGAGG + Intronic
1041161669 8:55050996-55051018 TTTGACTAGTTGAGAGAAGAAGG + Intergenic
1041750946 8:61260514-61260536 ATGGAGAGGTGGAGAGGAGATGG - Intronic
1042497412 8:69470645-69470667 CTGCAGTAGTAGACAGAAGAGGG - Intronic
1042672904 8:71283824-71283846 ATGGAAGAGTGGAGAGAACAGGG + Intronic
1042707950 8:71681428-71681450 TTTGAGTAGAAGGGAGAAGATGG - Intergenic
1042723319 8:71846600-71846622 ATGGAGTAGAAGAGAAAGGGAGG - Intronic
1043334156 8:79152068-79152090 ATGGAGCAAGAGAGAGGAGAAGG - Intergenic
1043535910 8:81204410-81204432 TTTGAGGAGTTGAGAGAAGAAGG - Intergenic
1043767441 8:84154469-84154491 AGGGAATTGTAGAGATAAGAAGG - Intergenic
1044029052 8:87211614-87211636 AAGGAGCAGGAGAGAGAATAAGG - Intronic
1044946404 8:97393842-97393864 CTGGAGTAGGCGAGAGCAGAAGG + Intergenic
1044968212 8:97594559-97594581 TTGGACGAGTTGAGAGAAGAAGG - Intergenic
1045419639 8:102001033-102001055 TTTGATGAGTAGAGAGAAGAAGG + Intronic
1045969162 8:108060191-108060213 TTTGACTAGTTGAGAGAAGAAGG + Intronic
1046042293 8:108920364-108920386 TTAGAGTTGTAGAGAGAAGACGG - Intergenic
1046058544 8:109108253-109108275 ATGGAGAAGGAGAGAGGTGATGG - Intronic
1046352814 8:113038515-113038537 ATGAAGTAGAAGAGAGTAAAGGG + Intronic
1046632727 8:116637484-116637506 CTGGAGTAGGAGAGAGAGAAAGG - Intergenic
1046832893 8:118765748-118765770 ATTGAGTTGGAGAAAGAAGAGGG + Intergenic
1046879598 8:119293184-119293206 TTTGACTAGTTGAGAGAAGAAGG + Intergenic
1047135775 8:122076494-122076516 AGGGAGTTCTAGAGATAAGATGG - Intergenic
1047739852 8:127797714-127797736 ATGGAGTTGTAGGGAGTAGAAGG - Intergenic
1047778729 8:128094684-128094706 AGGGAGGAATAGAGAGTAGAAGG - Intergenic
1048334737 8:133493924-133493946 GGGGAGAAGGAGAGAGAAGAAGG - Intronic
1050683857 9:8145347-8145369 GTGGAGATGCAGAGAGAAGAGGG + Intergenic
1050831083 9:10014321-10014343 ATGGAGAAGTGGAAAGAATATGG - Intronic
1050836264 9:10083080-10083102 ATAAAGAAGCAGAGAGAAGAAGG - Intronic
1051300533 9:15645395-15645417 TTTGAGGAGTTGAGAGAAGAAGG + Intronic
1051715013 9:19973485-19973507 AAGGAGTAGTAGATAGACGTGGG + Intergenic
1051928801 9:22361509-22361531 ATAGAGTAGTTAGGAGAAGAGGG + Intergenic
1052149977 9:25103143-25103165 TTTGACTAGTTGAGAGAAGAAGG + Intergenic
1052231940 9:26164710-26164732 ATGGGGAACTAGAGAGGAGAGGG - Intergenic
1052567601 9:30176731-30176753 ATGGAGTAGTTGAGAACAGTAGG + Intergenic
1053193739 9:36098037-36098059 CAGGAGGAGGAGAGAGAAGAGGG + Intronic
1053668548 9:40336505-40336527 AGGGAGTAAGAGAGAGAAGGGGG - Intergenic
1053918355 9:42962795-42962817 AGGGAGTAAGAGAGAGAAGGGGG - Intergenic
1054516063 9:66039789-66039811 AGGGAGTAAGAGAGAGAAGGGGG + Intergenic
1054834964 9:69667708-69667730 ATGGTGTAGTAGAGGGAAAGTGG - Intronic
1054896850 9:70323076-70323098 ATGGTGTAGTGGAAAGAACATGG + Intronic
1056577761 9:87869089-87869111 CTGTAGGAGAAGAGAGAAGATGG + Intergenic
1056861981 9:90193331-90193353 TTTGACTAGTTGAGAGAAGAAGG + Intergenic
1056999286 9:91492750-91492772 ATGGAGTAGCTGAAAGATGAAGG + Intergenic
1057430018 9:94985143-94985165 AGTGAGGAGGAGAGAGAAGATGG + Intronic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1057931361 9:99196291-99196313 GTGGAGAAGAAGAGAGCAGAAGG - Intergenic
1058805744 9:108589800-108589822 ATGGAGAACAAGAGTGAAGAAGG + Intergenic
1058861730 9:109123054-109123076 TTGGAGTAGGACAGAGAGGAGGG - Intergenic
1059012476 9:110477098-110477120 CTGGAATACAAGAGAGAAGAGGG - Intronic
1059355560 9:113696852-113696874 AAGGAGAAATAGAGAGAAGGGGG - Intergenic
1059673426 9:116513984-116514006 TTTGAGGAGTTGAGAGAAGAAGG - Intronic
1059675603 9:116536340-116536362 TTTGAGGAGTTGAGAGAAGAAGG - Intronic
1059743039 9:117171681-117171703 AGGCAGTAGGAGAGAGAAGAAGG - Intronic
1059794103 9:117672617-117672639 GTGGAGGAGGAAAGAGAAGATGG - Intergenic
1060102712 9:120854927-120854949 ATGGAGTGGTAGAAAGAAGTGGG + Intergenic
1060270023 9:122133639-122133661 ATGGACTGGCAGAGAGGAGAGGG + Intergenic
1060373506 9:123097802-123097824 ATGCAGAAGAAGAGAAAAGACGG + Exonic
1060502370 9:124170653-124170675 AGGGAGCAAGAGAGAGAAGAGGG + Intergenic
1060591113 9:124817511-124817533 ATGGGGTAGTGGGGAGCAGATGG - Intergenic
1060852433 9:126888878-126888900 ATGGAGTAGAACAGAGAGCAGGG - Intergenic
1061865656 9:133490746-133490768 AAGGAGAAGCAGGGAGAAGAAGG + Intergenic
1185547216 X:955137-955159 ATGGAATGGTAGATAGATGATGG - Intergenic
1185582422 X:1220939-1220961 ATGGAGGGGTAGATAGATGATGG + Intergenic
1186017816 X:5217990-5218012 AAGGAGGGGTAGAGAGAAGGAGG + Intergenic
1186429439 X:9492142-9492164 ATGGAGTAGTTGTGAGACGAAGG + Intronic
1187240191 X:17505919-17505941 GGGGACTAGTGGAGAGAAGAAGG - Intronic
1187415289 X:19087841-19087863 AGAGAGTAGAAGAGAAAAGAGGG - Intronic
1188150751 X:26671795-26671817 TTGGGGTAGGAGAGAGAAAATGG - Intergenic
1188314031 X:28651872-28651894 AAGGAGTAGGAGAGATTAGATGG - Intronic
1188820583 X:34770182-34770204 ATGGACCAGTAGAGAGATGAGGG - Intergenic
1189175616 X:38954389-38954411 ATGGAACGGTAGAGAGAGGAGGG - Intergenic
1189178736 X:38983117-38983139 AAGGAGGAGGAGAGTGAAGAGGG + Intergenic
1189550221 X:42085105-42085127 ATGGAATAGGGGAGAAAAGAAGG - Intergenic
1189953546 X:46256390-46256412 AGGAAGTACTAGATAGAAGAAGG + Intergenic
1191656933 X:63608174-63608196 TTGGATGAGTTGAGAGAAGAAGG + Intergenic
1191681026 X:63839788-63839810 TTGGACAAGTTGAGAGAAGAAGG + Intergenic
1191792556 X:64986403-64986425 ATGTAGTAGCAGAGAGATGGGGG - Intronic
1192182391 X:68924353-68924375 GTGGAGCTGGAGAGAGAAGAGGG - Intergenic
1192204155 X:69085208-69085230 AGAGATGAGTAGAGAGAAGAAGG - Intergenic
1192602354 X:72478446-72478468 ATGGAGGAATAGAGAGGGGAGGG - Intronic
1192806456 X:74514111-74514133 ATTGAAAAGTGGAGAGAAGAAGG + Intronic
1193474025 X:81941372-81941394 TTCGACTAGTTGAGAGAAGAAGG + Intergenic
1193827431 X:86242844-86242866 ATGGAGCAGGAGAAAGAAGGGGG - Intronic
1194418535 X:93643573-93643595 AGGGAGAAATAGAGAGGAGAAGG + Intergenic
1194942840 X:100032923-100032945 ATGGAAGGGTAGAGACAAGATGG - Intergenic
1195403065 X:104482532-104482554 ATGGAGTAGTCGAAAGATCAGGG - Intergenic
1195683736 X:107567532-107567554 ATGAATTAGCAGAGAGAAGTGGG + Intronic
1196545042 X:116952843-116952865 ATGGTGTAGTGGAAAGATGATGG + Intergenic
1197431721 X:126375644-126375666 ATGGACAAATAAAGAGAAGAGGG + Intergenic
1197485182 X:127040482-127040504 ATAGAGTAGTAGAGACAAATAGG + Intergenic
1197734366 X:129839849-129839871 AGGGAGTAGTGGGAAGAAGAGGG - Intronic
1197943414 X:131813323-131813345 ATGGAATGGGAGGGAGAAGAAGG + Intergenic
1198074534 X:133181899-133181921 ATGGGGTAGGAGACAGCAGAGGG + Intergenic
1198145750 X:133855765-133855787 TTGGAGTAGTGGGGAGAAAATGG - Intronic
1198194931 X:134350695-134350717 AGGGAGAAAGAGAGAGAAGATGG - Intergenic
1198228082 X:134664806-134664828 ATAGAGAAGTAGAGCCAAGAGGG + Intronic
1198365994 X:135940753-135940775 TTTGACTAGTTGAGAGAAGAAGG - Intergenic
1198520801 X:137450453-137450475 ATGGAGAAAAAAAGAGAAGAGGG - Intergenic
1198584620 X:138106448-138106470 ATGGACGAGTTGAGAGAAGAAGG + Intergenic
1198741130 X:139844311-139844333 AAGGAGTAGCAGAGAGTGGAGGG + Intronic
1199101082 X:143801317-143801339 ATGCAGAAGAAAAGAGAAGAAGG + Intergenic
1199316543 X:146385336-146385358 AAGTAGGAATAGAGAGAAGATGG + Intergenic
1201107779 Y:10776245-10776267 ATGGAAAAGCATAGAGAAGAAGG - Intergenic
1201146283 Y:11067085-11067107 AGGGAGAAGAAGGGAGAAGAAGG + Intergenic
1201146385 Y:11067399-11067421 AGGGAGAAGAAGGGAGAAGAAGG + Intergenic
1201540079 Y:15096555-15096577 ATGGAGAGGGAGGGAGAAGAAGG - Intergenic
1201693890 Y:16802024-16802046 ATGGATAAGCAGAGAGTAGATGG + Intergenic
1201726122 Y:17153946-17153968 ATGGAGATGCAGAGAGTAGATGG + Intergenic
1202039169 Y:20664815-20664837 CTGGAGAAGTAAAGAGAATAAGG - Intergenic