ID: 929305684

View in Genome Browser
Species Human (GRCh38)
Location 2:40358856-40358878
Sequence ATATGCTTCTACAAGACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 180}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929305684 Original CRISPR ATATGCTTCTACAAGACTGA AGG Intronic
902369234 1:15994928-15994950 AGATGCTTCTAGAAGCCTGGAGG - Intergenic
902452709 1:16507825-16507847 ATCTGATTCTACAAGAGTAAGGG - Intergenic
902472769 1:16660489-16660511 ATCTGATTCTACAAGAGTAAGGG - Intergenic
902486035 1:16746954-16746976 ATCTGATTCTACAAGAGTAAGGG + Intronic
903207002 1:21789966-21789988 AAATGTTTCTTCAAGACTTAAGG - Intergenic
903680459 1:25093028-25093050 ATCTGCTTCTGCAAGAGTCAAGG - Intergenic
905854938 1:41304205-41304227 ATATGCTTCTACATGTCTTTTGG - Intergenic
908493806 1:64673759-64673781 ATATATTTATACAAGACTGTGGG - Intronic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
909769556 1:79403645-79403667 ATATTATTTTAAAAGACTGAGGG - Intergenic
909878190 1:80837995-80838017 TGATGCATCTACAAGACTTAAGG - Intergenic
912276795 1:108266887-108266909 ATATATTTCTACATAACTGATGG - Intergenic
912291435 1:108427468-108427490 ATATATTTCTACATAACTGATGG + Intronic
913154719 1:116084711-116084733 AGAAGCTTCTTCAAGCCTGAAGG - Intergenic
914914722 1:151812389-151812411 ATATGCTTTTGCCAGACTGTAGG + Intronic
915192965 1:154167554-154167576 ATCTGATTCTACCAGAGTGATGG - Exonic
915401478 1:155625138-155625160 AGATGGTCCAACAAGACTGAGGG - Intergenic
915773259 1:158453850-158453872 AAATGCTTCTACACTACTGGTGG + Intergenic
915783334 1:158578945-158578967 AAATGCTTTTAGAAGAATGATGG - Exonic
916115948 1:161485179-161485201 AGATGCTCCAACAGGACTGATGG - Intergenic
916640556 1:166724402-166724424 ATGCCCTTCTACAAGAGTGAAGG - Intergenic
917693850 1:177497739-177497761 ACATGCTTCTAAACAACTGAAGG + Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
918864456 1:189876545-189876567 ATATTCTTGCACCAGACTGATGG + Intergenic
920165268 1:204031345-204031367 TTTTGCTTCTGCAAGACTGCAGG - Intergenic
921853829 1:219959331-219959353 ATGAGCTTCTACATGACTCAAGG - Intergenic
924594678 1:245434905-245434927 ATATCCTTGTACAAGGATGAGGG - Intronic
924706790 1:246508827-246508849 AGATGCTTCTAGAAGCCTGGAGG + Intergenic
1064945181 10:20779153-20779175 ATATGCTTCTCCTACACAGAGGG - Intergenic
1065365787 10:24935750-24935772 GTTTGCTTCTTCAAGTCTGACGG - Intronic
1068357565 10:55929423-55929445 TTATCCTTCTCAAAGACTGATGG - Intergenic
1068941921 10:62689015-62689037 ATTTGCTTCTTCAAGCCTGGCGG - Intergenic
1070851664 10:79568186-79568208 ATATGCTTCTGAAAGACCAATGG - Intergenic
1075018948 10:118933625-118933647 ATATGCTTCTAAATAACTCACGG + Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078712504 11:13808065-13808087 ATATGCTTATACATGTCTCAAGG - Intergenic
1080158319 11:29139769-29139791 ATATGTGTATACAAAACTGATGG - Intergenic
1081144071 11:39539519-39539541 ATATGCTTCTGAATGACAGATGG - Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1087535876 11:99444542-99444564 ATCTGCTTATACAAGAATAAAGG - Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1093224065 12:16459962-16459984 TTCTGTTTCTACAAGACAGAAGG - Intronic
1095317872 12:40788338-40788360 AGGTGCTTCTACATGACAGATGG - Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1099717822 12:86319048-86319070 CTACCCTTCTACAAGACTCAGGG + Intronic
1100120739 12:91366725-91366747 ATTTCCTTCTTCAAGCCTGAGGG + Intergenic
1100382345 12:94073565-94073587 AGATGCTTCCACAAGCCAGATGG + Intergenic
1100782797 12:98047258-98047280 ATATGCTTCTTAAAGAATGAGGG - Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1102003025 12:109569938-109569960 ATTTGTTTCTAGAAGACAGAAGG - Intronic
1103931760 12:124454341-124454363 AGAGGCTTCCACAAGGCTGATGG - Intronic
1107210636 13:37849968-37849990 ATAAGCTGCAACAATACTGATGG + Intronic
1109068018 13:57725242-57725264 ATAAGCTTTTGCAAGACTGCCGG + Exonic
1109688452 13:65852011-65852033 ATATGCTTTTACAATACTAATGG + Intergenic
1110858116 13:80319165-80319187 CTATGCTTCTACTGAACTGATGG - Intergenic
1111446888 13:88357843-88357865 ATATGCTCCTAAATGACTGTGGG + Intergenic
1111594602 13:90395612-90395634 ATGCCCTTCTAGAAGACTGATGG - Intergenic
1113966733 13:114156753-114156775 ATATGCCTCAAAAAGACAGATGG - Intergenic
1115873738 14:37837221-37837243 ATTTGCTTTTACATGATTGAAGG + Intronic
1116650616 14:47587028-47587050 ATGTGCTCCTACAATAATGAAGG + Intronic
1116802884 14:49461809-49461831 ATGTGCTTCTGGAAGGCTGAAGG - Intergenic
1117211329 14:53503555-53503577 ATGTGCGTCCACAAGACAGATGG + Intergenic
1117357655 14:54941045-54941067 ATATGTTTCTACTAGACCTAGGG - Exonic
1117709657 14:58513153-58513175 CTATGTTTCTACAAGGCTGTTGG + Intronic
1117712773 14:58549688-58549710 ATATTCATCTACAAGACTCTGGG + Intronic
1118355481 14:65010110-65010132 AGATGCTGCAGCAAGACTGAGGG - Intronic
1120212797 14:81650679-81650701 ATATGGTGCTGCAAGACTGTGGG + Intergenic
1125233907 15:37489608-37489630 ATATTCTACTTGAAGACTGAGGG + Intergenic
1125248014 15:37664250-37664272 ATATGCTTCTAAAGGACTTTCGG - Intergenic
1131357699 15:91759957-91759979 ATATGTTTCTACAAGATAAAGGG - Intergenic
1139076531 16:63456979-63457001 ATATGGTTCTACAACACTGTAGG - Intergenic
1140418985 16:74801214-74801236 ATATGCTTCTAAATAACTGATGG + Intergenic
1140859702 16:79008245-79008267 GTTGGCTTCTTCAAGACTGAAGG + Intronic
1142029646 16:87832134-87832156 CTCTGTTTCTAGAAGACTGAAGG + Exonic
1143206072 17:5139850-5139872 AGATGCTTCTAGAAGCCTGGAGG - Intronic
1146842539 17:36165987-36166009 AGATGCTTCTAGAAGCCTGGAGG + Exonic
1146854851 17:36253946-36253968 AGATGCTTCTAGAAGCCTGGAGG + Exonic
1146865769 17:36334430-36334452 AGATGCTTCTAGAAGCCTGGAGG - Exonic
1146870751 17:36377838-36377860 AGATGCTTCTAGAAGCCTGGAGG + Exonic
1146878109 17:36428919-36428941 AGATGCTTCTAGAAGCCTGGAGG + Exonic
1146882050 17:36450023-36450045 AGATGCTTCTAGAAGCCTGGAGG + Intergenic
1147068639 17:37935042-37935064 AGATGCTTCTAGAAGCCTGGAGG - Exonic
1147073634 17:37978462-37978484 AGATGCTTCTAGAAGCCTGGAGG + Intronic
1147080161 17:38014579-38014601 AGATGCTTCTAGAAGCCTGGAGG - Intronic
1147085156 17:38058000-38058022 AGATGCTTCTAGAAGCCTGGAGG + Exonic
1147096110 17:38138539-38138561 AGATGCTTCTAGAAGCCTGGAGG - Intergenic
1147101102 17:38181966-38181988 AGATGCTTCTAGAAGCCTGGAGG + Intergenic
1147288625 17:39423217-39423239 ATAAGTTTCTTCAAGACTGCTGG - Intronic
1147931797 17:43986333-43986355 ATATGCCTGTTCAAGACAGATGG + Intronic
1149845693 17:60008429-60008451 AGATGCTTCTAGAAGCCTGGAGG + Intergenic
1150084041 17:62265009-62265031 AGATGCTTCTAGAAGCCTGGAGG + Intergenic
1155527346 18:26730719-26730741 ATAGGCTTATAAAAGACTGACGG - Intergenic
1156031990 18:32723420-32723442 ATTTGCTTTCAGAAGACTGAGGG + Intronic
1156073339 18:33240121-33240143 ATATGCTTCTGAAAGACCAATGG + Intronic
1156994821 18:43452577-43452599 CTGTGTTTCTACAAAACTGAGGG - Intergenic
1157013303 18:43678854-43678876 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1157934630 18:51859353-51859375 ATCTGCTTATTCTAGACTGAGGG - Intergenic
1164809028 19:31141516-31141538 ATCAGCTTCTACATGACTGGAGG + Intergenic
1164992838 19:32696921-32696943 AGATGATGCAACAAGACTGAGGG - Intronic
1166583667 19:43926167-43926189 ATATGCCTCTCCATGTCTGATGG - Intronic
1202705161 1_KI270713v1_random:17309-17331 ATCTGATTCTACAAGAGTAAGGG - Intergenic
928442714 2:31305332-31305354 AGATGCTCCTTCAGGACTGAAGG + Intergenic
929305684 2:40358856-40358878 ATATGCTTCTACAAGACTGAAGG + Intronic
939289985 2:140181696-140181718 AAATGGTACTAAAAGACTGAGGG + Intergenic
939447162 2:142324862-142324884 CTCTGATTCTACAAGACTGGTGG - Intergenic
943559641 2:189445402-189445424 ATGTGCTTCTACACGACGGTGGG - Intronic
943898152 2:193394552-193394574 AAATGCATCTACAATAGTGAAGG - Intergenic
944620803 2:201514152-201514174 AAATTCTTCTAGAATACTGAAGG + Intronic
945520686 2:210823697-210823719 CTATGCTTATAAAATACTGAGGG - Intergenic
945634637 2:212332453-212332475 AAATGCCTCTATAAGCCTGAGGG + Intronic
946818255 2:223602907-223602929 ATATGATTTTAAAAGAATGATGG - Intergenic
1169773388 20:9225753-9225775 ATCTGCTTCTATAAGAGAGAGGG + Intronic
1170314697 20:15030162-15030184 ATCTGCATCTCCATGACTGAGGG + Intronic
1173108008 20:40156255-40156277 CTATGCTTCTGGAAGACTGAAGG - Intergenic
1178272505 21:31204769-31204791 ATGTGCTTTTACAAGAATGCAGG - Intronic
1182898564 22:33878855-33878877 ATATGGTTTTAAAAGAGTGAGGG + Intronic
950250760 3:11463401-11463423 AATTGGTTCAACAAGACTGAAGG - Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
952452512 3:33445446-33445468 GTCTGTATCTACAAGACTGAAGG + Intergenic
956054492 3:65284226-65284248 ACATGCTCCTCCAAGACTAAGGG + Intergenic
957361987 3:79173003-79173025 ATCTGCCTCTATAACACTGAAGG + Intronic
957903444 3:86528003-86528025 ATATGCTCCTTAATGACTGATGG + Intergenic
958050547 3:88338692-88338714 ATAAGCTTATACAACACAGAAGG - Intergenic
958161788 3:89826108-89826130 ATTTGCTTCTTCAAGAAAGAGGG + Intergenic
958168279 3:89905699-89905721 AAATGTTTCTACAAGAATCATGG - Intergenic
962937905 3:140098478-140098500 AAATCCTTCAGCAAGACTGAGGG + Intronic
963385793 3:144592310-144592332 ATATGCTTCTACATTCATGAAGG - Intergenic
965792250 3:172402187-172402209 CTAGGCTTCTGCAAGAGTGATGG - Intergenic
966037904 3:175442786-175442808 TTATGCTTCATAAAGACTGAGGG - Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
969367978 4:6710561-6710583 AAGTGCTTCTACCAGACTGGAGG + Intergenic
972125167 4:35756201-35756223 ATATGCTTCTTAATGACTAATGG - Intergenic
972915417 4:43871633-43871655 ATATGCTTCTGAATGACTCAGGG - Intergenic
973138025 4:46731099-46731121 ACATGCTTCTACTAGCATGATGG - Intergenic
973813874 4:54600250-54600272 ATATCCTTCTACAGGACTGAAGG + Intergenic
974629467 4:64465015-64465037 ATATATTTTTAAAAGACTGAAGG - Intergenic
974810625 4:66941491-66941513 ATATTCTACTACAAAACAGAAGG + Intergenic
976815601 4:89145102-89145124 AAATGCTTATACACCACTGATGG - Intergenic
977080111 4:92515653-92515675 ATATACTTCTACAATACCCAAGG - Intronic
977923538 4:102672423-102672445 AAATGTTTTTCCAAGACTGAAGG - Intronic
980935007 4:139218132-139218154 ATAGGCATCTAAAATACTGAAGG - Intergenic
981201305 4:141982806-141982828 ATATCCTTTTAGAAGATTGAAGG - Intergenic
984738192 4:183131569-183131591 ATTTGCTTCTAAAATACTTAAGG - Intronic
984744161 4:183197551-183197573 ATATGATCATACAACACTGATGG - Intronic
985009244 4:185565833-185565855 AGAGGCTTCTAGAAGACTGAGGG + Intergenic
987017951 5:13839138-13839160 CTCTGCCTCTATAAGACTGAAGG + Intronic
988266514 5:28958544-28958566 ATATGATTGAAGAAGACTGATGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
994702517 5:103154237-103154259 ATTTTCTTCTAAAAGGCTGAGGG - Intronic
995099905 5:108287645-108287667 GAATGCTTCTACACCACTGATGG + Intronic
995222407 5:109664865-109664887 ATATGCATCTAAAAGACAGAAGG - Intergenic
999148370 5:149410626-149410648 ATATGCTTCAAGGAAACTGATGG - Intergenic
1000996435 5:167963740-167963762 ACATGCTTCATTAAGACTGATGG - Intronic
1001459593 5:171898762-171898784 AAATGCTTCTGCAAGGCTGCCGG - Intronic
1002985788 6:2189784-2189806 ATATGCTACTACATAACTGATGG + Intronic
1003077444 6:2995548-2995570 ATATGCCTGTATAAGACTAAGGG + Intronic
1005138975 6:22604805-22604827 ATATGATTCTCCAGGACTGTAGG + Intergenic
1006290670 6:33133669-33133691 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1011655688 6:89549775-89549797 ATATGCTTCAAACAGACTGATGG + Intronic
1012376338 6:98565937-98565959 ATATGCTACTTCAAATCTGAAGG - Intergenic
1014739755 6:125135048-125135070 ATAAGTTTTTAAAAGACTGAAGG - Intronic
1014780806 6:125562402-125562424 ATATTTTTCTAACAGACTGAGGG + Intergenic
1014866537 6:126538205-126538227 CTATGTTTCAACAAAACTGAAGG + Intergenic
1015152252 6:130053256-130053278 AGATTCATCTACAAGACTGAAGG - Intronic
1016418998 6:143865064-143865086 ATATGCTTCATCAAGACTCATGG - Intronic
1017034518 6:150255254-150255276 ATATCCTTCTACAGCACTTAGGG + Intergenic
1028342957 7:89745583-89745605 ATATGCTGCTACAATGTTGAGGG + Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1031305387 7:120119664-120119686 ATGTCCTTCTAAAAGAATGAAGG - Intergenic
1036625249 8:10465460-10465482 ATATGTTTCTATAAGCCTGTAGG - Intergenic
1038045356 8:23761408-23761430 ATTGGCTTCTGCAGGACTGAGGG + Intergenic
1043732671 8:83703669-83703691 ATATGATTCTACTTGGCTGATGG + Intergenic
1043823288 8:84894894-84894916 ATATGCTTCTGTCAGACTGCAGG - Intronic
1044302477 8:90601883-90601905 ACATGCTACTACCAGAATGAAGG - Intergenic
1046466782 8:114615154-114615176 ACATGCCTAGACAAGACTGATGG + Intergenic
1046487144 8:114901550-114901572 ATACCCTTCTAGAAGAGTGAAGG - Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051289629 9:15532023-15532045 ATATGATTTTAAAAGAATGATGG - Intergenic
1055114676 9:72593772-72593794 CTAGGCTTCTCAAAGACTGAAGG + Intronic
1055624629 9:78163176-78163198 ATATACTTTTTTAAGACTGAAGG + Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056066445 9:82940501-82940523 ATTTGCTTTCACAAGACTGGAGG + Intergenic
1056480828 9:87004024-87004046 ATGTTCTTCTACAGGCCTGAGGG + Intergenic
1057126796 9:92622829-92622851 ATATGCTTGAAGAAGACAGAAGG + Intronic
1059663234 9:116422069-116422091 ATATACTACTTCAAGACTGTTGG - Intergenic
1059806246 9:117803703-117803725 ATATGCTTCTTGATCACTGAAGG + Intergenic
1060459490 9:123836321-123836343 ATATGAATTAACAAGACTGAAGG + Intronic
1189101845 X:38198633-38198655 GTAGGATTCTACAACACTGATGG + Intronic
1189873913 X:45414669-45414691 ATATGCTCCTGAATGACTGATGG - Intergenic
1190817654 X:53942672-53942694 ATATGCTTCTACAACATTCGTGG - Intronic
1194546897 X:95247242-95247264 ATATACTTCTAAAAGAATGAAGG - Intergenic
1197959313 X:131986633-131986655 AAATGTTTCTACAGGGCTGAAGG - Intergenic
1200967876 Y:9117391-9117413 ACATCCTTCTATAAAACTGAAGG + Intergenic
1202023855 Y:20498812-20498834 ATATGCTTCTAAATGACAGGTGG - Intergenic