ID: 929306838

View in Genome Browser
Species Human (GRCh38)
Location 2:40372982-40373004
Sequence GGGGATTGCAAGGCTGCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 218}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929306838_929306844 5 Left 929306838 2:40372982-40373004 CCAACAGCAGCCTTGCAATCCCC 0: 1
1: 0
2: 1
3: 13
4: 218
Right 929306844 2:40373010-40373032 AATGTACCCAACCAACTTAAGGG 0: 1
1: 0
2: 0
3: 6
4: 161
929306838_929306843 4 Left 929306838 2:40372982-40373004 CCAACAGCAGCCTTGCAATCCCC 0: 1
1: 0
2: 1
3: 13
4: 218
Right 929306843 2:40373009-40373031 AAATGTACCCAACCAACTTAAGG 0: 1
1: 0
2: 0
3: 5
4: 132
929306838_929306846 7 Left 929306838 2:40372982-40373004 CCAACAGCAGCCTTGCAATCCCC 0: 1
1: 0
2: 1
3: 13
4: 218
Right 929306846 2:40373012-40373034 TGTACCCAACCAACTTAAGGGGG 0: 1
1: 0
2: 1
3: 5
4: 79
929306838_929306845 6 Left 929306838 2:40372982-40373004 CCAACAGCAGCCTTGCAATCCCC 0: 1
1: 0
2: 1
3: 13
4: 218
Right 929306845 2:40373011-40373033 ATGTACCCAACCAACTTAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929306838 Original CRISPR GGGGATTGCAAGGCTGCTGT TGG (reversed) Intronic
900129067 1:1080023-1080045 GGGGCCTTCCAGGCTGCTGTGGG + Intergenic
900660113 1:3777955-3777977 GGGGCTGGCAGGGCTGCTGGTGG - Intergenic
901185841 1:7372703-7372725 TGGGGCTCCAAGGCTGCTGTGGG - Intronic
902919959 1:19659844-19659866 GGGGACTGCAAGGCTGCAGGCGG + Intergenic
903877168 1:26483067-26483089 GGGGATTGCAAAGGGGCTGGAGG - Intergenic
904715748 1:32466196-32466218 GTGGAATTCAAGGCTGCTTTTGG + Intronic
905825514 1:41023465-41023487 GGGGATGGCATGCCTGCTGTGGG - Intergenic
909595326 1:77399816-77399838 GAGGTTTAGAAGGCTGCTGTGGG + Intronic
912697563 1:111852903-111852925 GGGGAGGGAAAGGGTGCTGTGGG - Intronic
913003636 1:114606914-114606936 GGGGATTGCTCAACTGCTGTGGG - Intronic
915555522 1:156658775-156658797 GTGGAGTCCAAGGCTACTGTTGG - Intronic
916063187 1:161116154-161116176 AGGGATTTCAAGGCTGCAGCGGG + Intronic
918200418 1:182261075-182261097 GGTGACTGCAATGTTGCTGTGGG - Intergenic
921553989 1:216574945-216574967 GGAGAATTCAAGGGTGCTGTTGG - Intronic
1066037581 10:31508764-31508786 GGGGAGGGCAAGGTTGCTCTTGG + Intronic
1067541710 10:47159778-47159800 GGGGCCTGCCAGGCTGGTGTGGG - Intergenic
1068761938 10:60722141-60722163 GTGGATTGAAAAGCTGCTGTGGG - Intronic
1070109156 10:73465486-73465508 CAGGAGTTCAAGGCTGCTGTGGG + Intronic
1070797423 10:79224724-79224746 GGGGAAGGCCAGGCTGCTGCAGG + Intronic
1071294797 10:84211754-84211776 GGGGATTGGAAGGCTGAGGGTGG + Intronic
1071767148 10:88680059-88680081 GGAGATAGCAAAGCTGCTGTAGG - Intergenic
1071875670 10:89840324-89840346 GGGGATTGGGAGGCTGGTGGGGG - Intergenic
1073084116 10:100877419-100877441 CGGGATTTCAAGGTTCCTGTCGG - Intergenic
1074977932 10:118596016-118596038 GGAGATTGCAATGCAGCTGGGGG + Intergenic
1076384570 10:130047133-130047155 GGGGATTGGGTGGCTGCTTTTGG - Intergenic
1076645142 10:131948638-131948660 CGGGGCTGCAAGGCTGCTCTCGG - Intronic
1076753411 10:132555092-132555114 GTGGGTGGCATGGCTGCTGTGGG + Intronic
1076803369 10:132843334-132843356 GGGCATTCCCAGGGTGCTGTGGG + Intronic
1077552206 11:3205572-3205594 GGAGTTTGCATGGCTGCAGTGGG - Intergenic
1077837210 11:5935746-5935768 GGGCTTTGGAAGGCTGCGGTCGG - Intronic
1078964307 11:16320122-16320144 GGTGAATGCAAGGCTGCTGAAGG - Intronic
1079991244 11:27249084-27249106 GGCGATAGCAAGGCTGCAGAGGG - Intergenic
1080555775 11:33415961-33415983 AGGGATGTCAAGGCTGCAGTGGG + Intergenic
1085179087 11:74518520-74518542 TGGGAGTTCAAGGCTGCAGTGGG - Intronic
1087140607 11:94761969-94761991 GGGGATTACAAGGGTTCTTTAGG + Intronic
1088870157 11:113883829-113883851 CGGGAGTTCAAGGCTGCAGTGGG + Intergenic
1090406679 11:126479974-126479996 GGGGATGCCCAGGATGCTGTGGG - Intronic
1093339057 12:17949446-17949468 GGGGGATGCAAGGCTTCTTTTGG - Intergenic
1093619871 12:21276669-21276691 GGGGATGGGAGGGCTGGTGTTGG - Intronic
1096649850 12:53056988-53057010 GGGGATAGCAAGGCCAGTGTTGG - Intronic
1097086020 12:56469069-56469091 GAAGAGTGCCAGGCTGCTGTGGG - Exonic
1098288068 12:68928811-68928833 TGGGAGTTCAAGGCTGCAGTGGG - Intronic
1098800538 12:74951835-74951857 GGGGGTTTCAAATCTGCTGTGGG - Intergenic
1100220509 12:92499983-92500005 GGGGATTGCAGGGGGGCTATAGG + Intergenic
1102435700 12:112921666-112921688 GGGGTCTGCCAGGCTGGTGTGGG + Intronic
1103327043 12:120128643-120128665 TGGGCTTTCAAGGCTGCTGGGGG + Intronic
1104849455 12:131864385-131864407 TGGGAGTTCAAGGCTGCAGTGGG + Intergenic
1104966312 12:132510143-132510165 GGGGCTGGCAGGGCTGCTCTGGG - Intronic
1105263328 13:18796130-18796152 GGGGATTGGAAGGGGGATGTGGG - Intergenic
1105487564 13:20851634-20851656 GGGGAGGTCAAGGCTGCAGTAGG + Intronic
1105886734 13:24649099-24649121 GGGGGTGGCAGGGCTGCTGGAGG - Intergenic
1111604410 13:90519531-90519553 GGGAAATGCAGGGCTGCTGCTGG - Intergenic
1111945938 13:94665938-94665960 GGGGTTTGCAAGGGGGCTTTAGG - Intergenic
1113569439 13:111343356-111343378 GGAGGCTGCCAGGCTGCTGTGGG + Intronic
1113569457 13:111343424-111343446 GGAGGCTGCAGGGCTGCTGTGGG + Intronic
1115053415 14:29092633-29092655 GGGGTTTGTAAGGCTGCATTTGG - Intergenic
1117064762 14:52001466-52001488 GGGGATCGCAAGGCTCAGGTAGG + Intronic
1118354946 14:65005711-65005733 CAGGAATTCAAGGCTGCTGTGGG - Intronic
1119072644 14:71603530-71603552 TGGGAGTTCAAGGCTGCAGTAGG - Intronic
1122244585 14:100393516-100393538 GGTGCTGGCAGGGCTGCTGTGGG + Intronic
1122309915 14:100787938-100787960 GGGGCTTGCAGGGCTGCGGGAGG - Intergenic
1122345440 14:101055860-101055882 GGAGGGTGTAAGGCTGCTGTGGG - Intergenic
1122579452 14:102762385-102762407 GGGAATTGCAAGGGGGTTGTAGG + Intergenic
1123491118 15:20783537-20783559 GGGGATTGCATAGCTTCTGGGGG - Intergenic
1123547620 15:21352628-21352650 GGGGATTGCATAGCTTCTGGGGG - Intergenic
1125835350 15:42745896-42745918 TGGGTTTGCAATGCTCCTGTTGG + Exonic
1127682299 15:61309761-61309783 GGGCGTTGCACGACTGCTGTTGG + Intergenic
1129204461 15:74027818-74027840 GGGGATGGCAGTGCTGCTGAGGG + Intronic
1129253643 15:74321929-74321951 GAGGAGTGCCAGGCTGGTGTAGG + Intronic
1129470360 15:75750360-75750382 GGGGTTGGCAGTGCTGCTGTGGG + Intergenic
1129734649 15:77952754-77952776 GGGGGTGGCAGTGCTGCTGTAGG - Intergenic
1129840941 15:78743237-78743259 GGGGGTGGCAGTGCTGCTGTAGG + Intergenic
1129882377 15:79015950-79015972 GGAGAAGGCAAGGCTGCTGGCGG + Intronic
1131735098 15:95323625-95323647 GGGGATTGCATGCCTCCGGTTGG + Intergenic
1202955950 15_KI270727v1_random:79858-79880 GGGGATTGCATAGCTTCTGGGGG - Intergenic
1132558639 16:583655-583677 GAGCATCGCCAGGCTGCTGTGGG + Exonic
1133233329 16:4376601-4376623 GGGGATAGCATGGCTGGGGTGGG - Intronic
1134049754 16:11129088-11129110 GGGGCTGGCAAGGCTGGGGTTGG - Intronic
1142217858 16:88838588-88838610 GTGGCCTGCAGGGCTGCTGTGGG - Intronic
1144454034 17:15404498-15404520 GGAGACTGCAGGGCTGCTGGTGG + Intergenic
1144483019 17:15643079-15643101 GGGTATGGCAAGGATGGTGTGGG - Intronic
1144915663 17:18721952-18721974 GGGTATGGCAAGGATGGTGTGGG + Intronic
1145747685 17:27332417-27332439 GGGGATTGCCAGGCAGGGGTGGG + Intergenic
1145882815 17:28364522-28364544 GGGGATCCCAGGGCTGCTGGAGG + Exonic
1146132112 17:30287117-30287139 TGGGAGTTCAAGGCTGCAGTGGG - Intronic
1146762176 17:35488269-35488291 GGGGACAGCAGGGCTGCTCTGGG - Intronic
1147451791 17:40510257-40510279 GGGAAGTGCAGGGCTGCTCTTGG + Intergenic
1148939471 17:51195979-51196001 GGGGAGGTCAAGGCTGCAGTGGG - Intronic
1151211453 17:72547588-72547610 GGGACTTGCAAGGCTTTTGTAGG - Intergenic
1151896083 17:76981851-76981873 GGGGATTAAAAGGCTGTTTTAGG - Intergenic
1152359560 17:79825154-79825176 GTGGAGAGGAAGGCTGCTGTGGG - Intergenic
1152631595 17:81413128-81413150 GGGGAGCGTATGGCTGCTGTGGG - Intronic
1154181659 18:12144203-12144225 GGGCATTGCAGGGCTGCTACTGG + Intergenic
1154182245 18:12147381-12147403 GGGCATTGCAGGGCTGCTACTGG - Intergenic
1154427722 18:14284654-14284676 GAGGATTGGAAGGCAGATGTGGG + Intergenic
1154448713 18:14458226-14458248 GGGGATTGCATAGCTTCTGGCGG - Intergenic
1156361209 18:36386321-36386343 GGGGTTGGCAAGGGTGATGTGGG + Intronic
1156395896 18:36699649-36699671 GGGGAAAGCAGGGCTGCTGAAGG - Intronic
1158688569 18:59639194-59639216 CGGGAGTCCAAGGCTGCAGTGGG + Intronic
1160609458 18:80074031-80074053 AGGGATGGCCAGGGTGCTGTGGG + Intronic
1160881841 19:1324544-1324566 GGGGATGCCAAGCCTGCTGAGGG + Intergenic
1162497146 19:11029597-11029619 GTGGATGGCCAGGCTACTGTGGG + Intronic
1164428282 19:28164484-28164506 AGGGACTGCAAAGCTGCTATGGG + Intergenic
1165131441 19:33634968-33634990 GGGGTGAGCAAGGCTGCTGGGGG - Intronic
1165191496 19:34067492-34067514 GGCCATTGCAGGGCTTCTGTGGG - Intergenic
1165421530 19:35724422-35724444 TGGGAGTTCAAGGCTGCGGTGGG + Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1167300109 19:48673129-48673151 GGGGATAGCGTGGCTGCGGTTGG - Intergenic
926728160 2:16014566-16014588 GGGGCTTGCCTGGCTGCTGAGGG - Intergenic
927088548 2:19693265-19693287 GGGGGTTGCCAGTTTGCTGTGGG - Intergenic
927940252 2:27099124-27099146 GGGCAACGCTAGGCTGCTGTTGG + Intronic
929306838 2:40372982-40373004 GGGGATTGCAAGGCTGCTGTTGG - Intronic
929868234 2:45736358-45736380 GGGAGTTGGAAGGCTGCTCTGGG + Intronic
935184802 2:100722292-100722314 GGAGATTCCTAGGCTGCTGTAGG + Intergenic
938406995 2:131038322-131038344 GGGGGCTGCAAGGCTGCAGGAGG - Intronic
938407043 2:131038504-131038526 GGGCACTGCAAGGCTGCAGGAGG - Intronic
938407052 2:131038535-131038557 GGGGGCTGCAAGGCTGCAGGAGG - Intronic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938936180 2:136129502-136129524 GGCAATTGCAAGGCTGCTAATGG + Intergenic
938936312 2:136130756-136130778 GGGAATTGCAAGGCTGCTAATGG - Intergenic
939888471 2:147707344-147707366 GGGGATTAAGAGGCTGCTGAGGG + Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
943728409 2:191275945-191275967 GGGGATTACCATTCTGCTGTTGG + Intronic
947422535 2:229953938-229953960 TGGGAGTTCAAGGCTGCAGTGGG - Intronic
947996756 2:234534491-234534513 GGGAAGAGCAAGGCTGGTGTGGG + Intergenic
948191026 2:236058954-236058976 CAGGATTTCAAGGCTGCAGTGGG + Intronic
1169365269 20:4987059-4987081 GGGGACTGCAGGGCTGCAGGTGG + Intronic
1170617854 20:17968630-17968652 GGGGACTGGGAGGCTGCTCTGGG - Intronic
1171869905 20:30516393-30516415 GAGGGTTGCAAGGGTGCTGCTGG - Intergenic
1171870694 20:30522174-30522196 GTGGGTTGCAAGGATGCTGCTGG - Intergenic
1175402374 20:58707884-58707906 GGGTCTTGCAAGGTTGCTATGGG - Intronic
1175465793 20:59190871-59190893 GGGGATTGTCAGGCTTCCGTTGG + Intergenic
1181040932 22:20192359-20192381 GGGGAGAGGAAGGCTGCTCTGGG - Intergenic
1182147954 22:28008790-28008812 GGGCTCTGCAGGGCTGCTGTAGG - Intronic
1182392996 22:30015118-30015140 TGGGAGTTCAAGGCTGCAGTGGG - Intronic
1184868880 22:47220346-47220368 CCAGATTGCAAGGCTGCTGCAGG - Intergenic
949988103 3:9554896-9554918 CAGGAGTTCAAGGCTGCTGTGGG + Intergenic
951102872 3:18709658-18709680 TTGGAGTGCAAGGCTGCAGTAGG + Intergenic
952490466 3:33866495-33866517 GTGGATAGTAAGACTGCTGTGGG - Exonic
955185592 3:56711910-56711932 TGGTATTGGAAGGCTCCTGTTGG + Intergenic
958464709 3:94443242-94443264 GGGGGTGGCAAGGCAGCTGGGGG - Intergenic
962792605 3:138824985-138825007 GGGGAGGTCAAGGCTGCAGTGGG + Intronic
963260834 3:143189351-143189373 GGGGAGAGCAAGGTTGCAGTTGG - Intergenic
964458997 3:156901069-156901091 GGGGTTGGCGAGGCTGCAGTGGG - Intronic
965388402 3:168073829-168073851 AGGGATGGCAGGGCTACTGTAGG + Intronic
966754528 3:183355989-183356011 GAGGTTTGCAAGGCTGCAGATGG - Intronic
967114790 3:186327458-186327480 CAGGAGTTCAAGGCTGCTGTGGG - Intronic
969603632 4:8191015-8191037 GGGAGCTGCAGGGCTGCTGTGGG + Intronic
969610624 4:8225850-8225872 GGGGAAGGGAAGGCTGTTGTAGG + Intronic
969901197 4:10351313-10351335 TGGGATTGAAAAGCAGCTGTTGG + Intergenic
970160100 4:13179660-13179682 TGGGGGAGCAAGGCTGCTGTTGG - Intergenic
970193673 4:13536804-13536826 GGGGATTGCAAGGGTCCTGTAGG - Intergenic
977362839 4:96028640-96028662 GGGAACTGCAAGGTTGCTGAGGG + Intergenic
977649663 4:99454811-99454833 GGGAAGTGCAATGCTGCTATTGG + Intergenic
977853097 4:101854151-101854173 GGGGGTTTCAGGGCTGCTTTTGG + Intronic
984643394 4:182195564-182195586 GGGGAGGTCAAGGCTGCAGTGGG + Intronic
986928993 5:12795057-12795079 GGGGACAGCCAGGCCGCTGTGGG + Intergenic
986962492 5:13232255-13232277 GGAAATTGGAAGCCTGCTGTTGG + Intergenic
988715357 5:33821804-33821826 GAGGATTGAAAGGGTGATGTTGG - Intronic
988936861 5:36092588-36092610 GAGCATTGCCAGGCTGCTGCTGG - Intergenic
991600994 5:68351143-68351165 GGGTATAGCAAGACTGTTGTTGG - Intergenic
993128381 5:83863486-83863508 TGGGATTGCAAGACTGCGATTGG + Intergenic
993175722 5:84482699-84482721 TGGGTATGCCAGGCTGCTGTGGG + Intergenic
994002712 5:94799917-94799939 CAGGATTACAAGGCTGGTGTCGG - Intronic
997257030 5:132437042-132437064 GGGGAATGCAAAGTTGCTGGGGG - Intronic
999269025 5:150285653-150285675 GGGGTTGCCAAGGCTGCAGTTGG - Intronic
1001254303 5:170171869-170171891 GGGGAGGGCAAGGGTGCTGCGGG - Intergenic
1001597523 5:172907627-172907649 GGGGAGGGCATGGCTGCTTTGGG - Intronic
1002432540 5:179211857-179211879 GGGGATTGGATGGCTGCTGGGGG - Intronic
1003145992 6:3511201-3511223 CGGGATGGCAAGGGTGCTGAGGG + Intergenic
1006322972 6:33331364-33331386 GGGGAGATCAAGGCTGCAGTGGG - Intergenic
1006665722 6:35691627-35691649 GGGGCTAGCAAGGCTGCCATCGG - Intronic
1010661893 6:78581110-78581132 GGGGACTGCAAGGCTGGAGGAGG + Intergenic
1010863037 6:80937434-80937456 GGGGCTTGCTGGGCTGCTATGGG + Intergenic
1011225204 6:85097321-85097343 GGGGCTTGTATGGCTGCTGTGGG - Intergenic
1016394183 6:143605046-143605068 GGCAACAGCAAGGCTGCTGTGGG - Intronic
1019212845 6:170420471-170420493 GAGGGTTGCCAGGGTGCTGTGGG + Intergenic
1019317482 7:395088-395110 TGGGAGTTCAAGGCTGCAGTGGG + Intergenic
1019523067 7:1469209-1469231 GGGGACTGGGAGGCTGCTCTGGG - Intergenic
1023166326 7:37347086-37347108 GGGCATAGCAAGGCTCCTCTGGG + Intronic
1023791394 7:43756512-43756534 GGGGACAGTAAGACTGCTGTAGG - Intergenic
1024143116 7:46481697-46481719 GTGGATTGCAAGTCTCCAGTAGG - Intergenic
1024517593 7:50272479-50272501 GGGATTTCCCAGGCTGCTGTAGG + Intergenic
1025806316 7:64837383-64837405 GGGCTTTGGAAGGCTGCAGTTGG + Intergenic
1026771963 7:73207826-73207848 GGCCATGGCAAGGCTGCCGTTGG + Intergenic
1027012831 7:74761222-74761244 GGCCATGGCAAGGCTGCCGTTGG + Intergenic
1027075209 7:75184831-75184853 GGCCATGGCAAGGCTGCCGTTGG - Intergenic
1028792563 7:94869348-94869370 GTGGATAGCAGGGCTACTGTTGG + Intergenic
1035010407 7:155710809-155710831 GGGGGATGCAAGGCTGCTACAGG + Intronic
1036272592 8:7321052-7321074 GGGAATTGGAAGGCTGTTCTTGG - Intergenic
1036348756 8:7989292-7989314 GGGAATTGGAAGGCTGTTCTTGG + Intergenic
1036773502 8:11594281-11594303 GGGCCTTTCAAGGCTGCTGATGG + Intergenic
1036778669 8:11630935-11630957 GGGGATAGCAAGCCTGCAGGAGG - Intergenic
1036922733 8:12873365-12873387 GGGGATTGGAAAGCTGCTTCTGG + Intergenic
1039797872 8:40930818-40930840 GGAGATTTTAAGACTGCTGTTGG - Intergenic
1041224019 8:55680536-55680558 GGTGTTGGCAAGGCTGCTCTAGG - Intergenic
1041375485 8:57206781-57206803 GGTGATTGCAGGGGTGCTGGGGG + Intergenic
1041376248 8:57211160-57211182 GGTGATTGCAGGGGTGCTGGGGG + Intergenic
1041719610 8:60964251-60964273 GGGGATTGGAAGGGTGCTGATGG + Intergenic
1041765590 8:61415051-61415073 AGCGATTGCAATGCTGCTCTGGG + Intronic
1043440852 8:80276047-80276069 GGTGATGCCAAGGCTGCTGCTGG - Intergenic
1047690754 8:127352060-127352082 GCAAATTGCAAAGCTGCTGTGGG + Intergenic
1048087165 8:131196149-131196171 GGGGAGGTCAAGGCTGCAGTGGG - Intergenic
1049332744 8:142063833-142063855 GGGGGTTCCCAGGCTGCTGCCGG - Intergenic
1049468264 8:142763608-142763630 GGGGAGTGCCAGGCTTATGTGGG + Intergenic
1049567351 8:143348018-143348040 CTGGCTTGCAAGGCTGCTGTGGG - Intronic
1051825148 9:21211276-21211298 GGGAATTGCAGAGCTGCTGTTGG - Intronic
1057082743 9:92185118-92185140 GGGGATGTGAAGGGTGCTGTGGG + Intergenic
1059999287 9:119943847-119943869 AGGGACTGCAGGGCAGCTGTGGG + Intergenic
1060512410 9:124243512-124243534 GGGAGTTGCAAGGCAGTTGTTGG - Intergenic
1060754492 9:126202981-126203003 GGGGGTTGCCTGACTGCTGTGGG + Intergenic
1061406039 9:130393585-130393607 GGGGATGGAGAGGATGCTGTGGG + Intronic
1062027411 9:134346915-134346937 GGGGAGGGCAAGGCTGGTGGGGG + Intronic
1062318223 9:135978431-135978453 GGGGTGTCCAGGGCTGCTGTGGG - Intergenic
1062653278 9:137589547-137589569 GGGGATTCCATGGCACCTGTGGG - Intronic
1185465330 X:351054-351076 GGGGATTGCAGTGCTGCTATGGG + Intronic
1185859665 X:3565795-3565817 TGGGATTTGAAGGCTGCAGTGGG + Intergenic
1187161033 X:16765561-16765583 TGGTATTCCAAGGCTGTTGTGGG + Intergenic
1187378822 X:18781564-18781586 GAGGACTGCAAGGCATCTGTTGG + Intronic
1189338700 X:40187651-40187673 AGGGAGTTCAAGGCTGCAGTGGG - Intergenic
1189809209 X:44765333-44765355 GGGCATTACCAGGTTGCTGTGGG - Intergenic
1190816884 X:53937446-53937468 GGGGATTTCAAGGCAGCAGAGGG - Exonic
1192639296 X:72847252-72847274 GTGGGTTGCAAGGCTGGTGCAGG - Exonic
1192642415 X:72873553-72873575 GTGGGTTGCAAGGCTGGTGCAGG + Exonic
1194754544 X:97722990-97723012 GGGTAGTGCAGGGCTGCAGTGGG - Intergenic
1195729545 X:107952064-107952086 GGGGAGGTCAAGGCTGCAGTGGG + Intergenic
1196270194 X:113700498-113700520 GTGCATTACAAGGCTGCTGCTGG + Intergenic
1196400493 X:115311618-115311640 AGGGCTTGAAAGGCTGCGGTTGG - Intergenic
1196470463 X:116018416-116018438 AGGGATTTCAATGCTGCAGTGGG - Intergenic
1200081032 X:153576442-153576464 TGGGATGGGAAGGCTGCTGGTGG + Intronic