ID: 929307126

View in Genome Browser
Species Human (GRCh38)
Location 2:40376219-40376241
Sequence TGTACATTGTTAGATGCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929307126_929307127 -2 Left 929307126 2:40376219-40376241 CCTTAAGCATCTAACAATGTACA 0: 1
1: 0
2: 1
3: 14
4: 138
Right 929307127 2:40376240-40376262 CAATTTACATTGTACCTCAACGG 0: 1
1: 0
2: 1
3: 16
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929307126 Original CRISPR TGTACATTGTTAGATGCTTA AGG (reversed) Intronic
900961459 1:5923750-5923772 TGAAAATTGTTAGATCCTTTTGG - Intronic
906787537 1:48629129-48629151 AGTACATAGTTAGATGCTAGTGG + Intronic
909004858 1:70264136-70264158 TTTACATTTTTAAATGTTTAGGG + Intronic
910593070 1:88948887-88948909 TGACCATTGTTAAATGGTTATGG - Intronic
910652879 1:89588892-89588914 TTTACATTTTTAGATGGTTGGGG + Intronic
911436199 1:97861645-97861667 TGAACATCGTTTTATGCTTAGGG - Intronic
912156467 1:106927162-106927184 TGTACTTTGTGAGCTACTTAGGG + Intergenic
912657971 1:111504639-111504661 TGTACATATTTAGATGCTTAAGG - Intronic
914426513 1:147582605-147582627 TTTACATGTTTAAATGCTTAGGG + Intronic
916324282 1:163539975-163539997 TATACAATGTTAGGTGCTGATGG + Intergenic
916330003 1:163604748-163604770 TCTATATTGTTAGATTCTTGGGG + Intergenic
917236390 1:172897038-172897060 TATACATGTATAGATGCTTAGGG + Intergenic
918487895 1:185048373-185048395 TGTATCTTGTTGGATGCTCAAGG + Intronic
920684430 1:208098328-208098350 TGTACCTTGATAGATAGTTAAGG + Intronic
921163945 1:212492625-212492647 TTTACATTTTTAAATGTTTAAGG + Intergenic
924657324 1:245984758-245984780 TGAACATGTTTATATGCTTAGGG - Intronic
1064169479 10:13017610-13017632 TGTAGATTTTTAGATACTAATGG + Intronic
1070410124 10:76131966-76131988 TACACATTTTTAAATGCTTAAGG - Intronic
1073027108 10:100496114-100496136 AGTAGATTGTGAGGTGCTTAAGG + Intronic
1074918000 10:117976845-117976867 TGTACATCTTTAGGTGATTAGGG - Intergenic
1077754402 11:5010327-5010349 TGTAAAATGTTAGATGTTAATGG + Intergenic
1078201014 11:9183212-9183234 AGCACATTATTAAATGCTTAAGG + Intronic
1079881052 11:25927115-25927137 TGTGTATTGTTCGATGTTTAAGG - Intergenic
1084200887 11:67557414-67557436 TTTACCTTTTTATATGCTTAAGG + Intergenic
1087549903 11:99636134-99636156 TGTCCATTGGTATATGCATATGG - Intronic
1087601242 11:100318692-100318714 AGTACATTGTCAGGTGCTTAAGG - Intronic
1088062157 11:105667752-105667774 TGTACATTGTGAAATGATCATGG + Intronic
1094180081 12:27583277-27583299 GGAACACTGTTAGATGCTTCTGG + Intronic
1098784296 12:74730527-74730549 TCTTTATTGTTAGCTGCTTAGGG + Intergenic
1099214172 12:79834060-79834082 GGTACATTGTTAGATGCTACAGG + Intronic
1099856418 12:88173447-88173469 GGCACTTTGTTATATGCTTAAGG - Intronic
1100248310 12:92787389-92787411 TATACATTGTTATATAATTAAGG + Intronic
1107757801 13:43644396-43644418 CATAAATTGTTAGATGCTAATGG - Intronic
1107773256 13:43811020-43811042 CCTACATTAATAGATGCTTAGGG + Intergenic
1109121552 13:58464105-58464127 TGCACATTGTTAAATGCTACTGG - Intergenic
1110279746 13:73679187-73679209 TGGACAATGTTGGTTGCTTATGG + Intergenic
1111071115 13:83169577-83169599 TTTACATTATTACATGCTTTTGG + Intergenic
1114552643 14:23542234-23542256 TGCACTTTGCAAGATGCTTAAGG + Intronic
1115953927 14:38755148-38755170 TGTACCATGTTAGAGGCTTTGGG - Intergenic
1117480474 14:56139089-56139111 GGCACATTGTTAGATAATTAAGG - Intronic
1120054576 14:79908345-79908367 GGAACATTGTTTTATGCTTAGGG + Intergenic
1121341707 14:93109067-93109089 TGTACATTGCTAGATGAGGAGGG - Intronic
1125185882 15:36929701-36929723 TATGCAATGGTAGATGCTTAAGG + Intronic
1125256100 15:37764895-37764917 TCTAAATTGTTAGAAGTTTAGGG - Intergenic
1125995247 15:44153666-44153688 TGTACATTTTAAAATGGTTAAGG + Intronic
1127733687 15:61822398-61822420 TTTACATTTTTAAATGGTTAGGG - Intergenic
1134629992 16:15749653-15749675 TGTGCATTGTACAATGCTTAGGG + Intronic
1138840234 16:60493367-60493389 TTTACATTGTTTGATGCATCTGG - Intergenic
1139459901 16:67113292-67113314 TGTATAATGTTGGATGATTAGGG + Intronic
1141246691 16:82314390-82314412 TGAACAATGATAAATGCTTATGG + Intergenic
1145112772 17:20178691-20178713 TGAAAAATGTAAGATGCTTAAGG + Intronic
1146251647 17:31351008-31351030 CGTACATTGTTAGAATCTTAAGG - Intronic
1146316498 17:31811483-31811505 TGTACATTTTAAAATGATTAAGG + Intergenic
1150166560 17:62949616-62949638 TGTACATTAGTAGTTGCCTAGGG + Intergenic
1152854457 17:82656251-82656273 TGTAGATTCTTAGAAACTTAAGG - Exonic
1155929112 18:31686645-31686667 GTAACATTTTTAGATGCTTAAGG + Intergenic
1157043281 18:44064345-44064367 AGTACATTGTTATATGGTTAAGG - Intergenic
1165331928 19:35144889-35144911 TGTGCATTGCAAGCTGCTTAAGG + Intronic
1167864367 19:52312552-52312574 TGTTCATTGTTTGATTCTTTTGG + Intronic
925637029 2:5950397-5950419 TGAACATTTTTAAATCCTTAAGG - Intergenic
928901982 2:36329237-36329259 TATAGATTGTATGATGCTTAAGG + Intergenic
929307126 2:40376219-40376241 TGTACATTGTTAGATGCTTAAGG - Intronic
931077469 2:58732637-58732659 AACACATTGTTAGATGCTTAGGG + Intergenic
931190135 2:59992312-59992334 TGGAGATTGTTAGATGCTAATGG - Intergenic
932937614 2:76123848-76123870 TGTATATTTTTAGATACTTCTGG - Intergenic
934906742 2:98211485-98211507 TGTACATTGTTAGATTGCTAAGG + Intronic
939522227 2:143245644-143245666 TGAACATGGTTAGAGGCTGAAGG + Intronic
940698988 2:157017905-157017927 TGTACATTATTATATCCTTTTGG + Intergenic
945629141 2:212250300-212250322 TGTAAATTAATAGATGTTTAAGG - Intronic
946011604 2:216569028-216569050 TGTACATTGTTCAATTTTTATGG + Intronic
948871873 2:240804830-240804852 TGTGCTTTGTTAGGTGCTTTGGG - Intronic
1172891032 20:38264378-38264400 TGCACATTGTTGGTTGCATATGG - Intronic
1174720671 20:52808958-52808980 TATACATAGGTAGAGGCTTATGG - Intergenic
1178706261 21:34875898-34875920 TGTGTAATGTTAGTTGCTTAAGG - Intronic
1179789232 21:43746823-43746845 TCTACATTTTTAAATGGTTAGGG - Intronic
1183311347 22:37111620-37111642 TGTGAAGTGTGAGATGCTTATGG + Intergenic
1183711460 22:39506227-39506249 TGTGCAGTGTTTGATGCATAGGG - Intronic
951997010 3:28742066-28742088 TGTAGAGTGTTAGGTCCTTAAGG + Intergenic
952280520 3:31918802-31918824 TGTACATATTCAGATGTTTAAGG + Intronic
958104183 3:89051933-89051955 TGGACATTTTTAAATGCTTGGGG + Intergenic
963560978 3:146864670-146864692 TGTACATCATTCCATGCTTAAGG - Intergenic
964207326 3:154188948-154188970 TATGCATTTTAAGATGCTTAAGG + Intronic
964745593 3:160009277-160009299 TTTGCATTGTAAGATGCTTCTGG - Intergenic
966702304 3:182868102-182868124 TGTTTATTTTTAGATGCTTCTGG + Intronic
970696731 4:18686587-18686609 TTTACATTGTTAGAGGTATAAGG + Intergenic
971448880 4:26780952-26780974 TGTAATTTATTTGATGCTTAAGG - Intergenic
971774499 4:30944893-30944915 TATACATTGTGAGATTTTTAGGG + Intronic
972409944 4:38783471-38783493 TGTACATTTAAAAATGCTTAAGG - Intergenic
973900962 4:55470972-55470994 TGTTCATTTTTAAATGCTTCTGG + Intronic
977683482 4:99820876-99820898 TGTACATTTTGAAATGCTTGAGG - Intronic
978971851 4:114817395-114817417 TGTACATTATTTCATCCTTATGG + Intergenic
979450617 4:120866232-120866254 TGTGCATTCTTAGATGGCTAGGG - Intronic
979955033 4:126942041-126942063 TGTACATTATCATATGATTAAGG + Intergenic
981663866 4:147199384-147199406 TGTACATTCTTATATGATTGTGG - Intergenic
981968031 4:150630109-150630131 AGTTCATTGTAAGAAGCTTAAGG - Intronic
983095850 4:163560754-163560776 TTTAAATTATTAGATACTTAGGG - Intronic
984317135 4:178141831-178141853 TGGACATGGTTAGAGACTTAGGG + Intergenic
988149308 5:27355750-27355772 TGTAGATGGGTAGATTCTTAAGG + Intergenic
993333517 5:86628668-86628690 TTTAAATTGTAAGATGCCTAAGG + Intergenic
995122233 5:108548509-108548531 TTTAAATTGTGAGATTCTTATGG + Intergenic
996555485 5:124774473-124774495 TGTACATTATAAGATGTTGAGGG - Intergenic
997777157 5:136620522-136620544 TGAGCATGTTTAGATGCTTATGG - Intergenic
1000985035 5:167856974-167856996 TGTACTTTGTTAGGAGCTTTGGG + Intronic
1003889233 6:10549138-10549160 TGTGCATTGTAGGATGCTGAGGG - Intronic
1006978124 6:38122749-38122771 TATACCTTGATAAATGCTTATGG - Intronic
1010420723 6:75671954-75671976 TTTAAATTGTGAGAAGCTTAGGG - Intronic
1010421316 6:75679480-75679502 AGTACAGTGTTAGAAGTTTATGG + Intronic
1012050750 6:94341008-94341030 TGTATTTTGTTAGGCGCTTATGG - Intergenic
1013146483 6:107399230-107399252 GGTACCTTGTTAGAGGCTAAGGG - Intronic
1013642496 6:112099975-112099997 ACTACATTGTTAGATTCTCATGG + Intronic
1014439476 6:121457502-121457524 TGTATATTTTTAGTTGCTTGTGG + Intergenic
1016287261 6:142487216-142487238 TGTACACTGTTTCATGTTTAAGG + Intergenic
1016561968 6:145406291-145406313 TGTATATTGTTAGATACTTTAGG - Intergenic
1017163231 6:151385011-151385033 TATACAGTGTTAAATGGTTAGGG - Intronic
1017188209 6:151623920-151623942 TGAACATTTTTAAATGCTGATGG - Intergenic
1017216004 6:151908108-151908130 TGTACATTGTTAAAAACATAAGG - Intronic
1017570016 6:155734239-155734261 AGTACATTGTGAGATCCTTGAGG - Intergenic
1019959433 7:4446667-4446689 TTTACATTTTTAAATGCTTGGGG - Intergenic
1021327007 7:19284808-19284830 TGCACATTCTTAGAAGTTTAAGG + Intergenic
1023513095 7:40973977-40973999 TGTTCATAGTTAGCTGCTAATGG + Intergenic
1027510741 7:79076723-79076745 TCTACATTGTTAGTTCTTTAGGG - Intronic
1029497998 7:100908101-100908123 TTTACATTTTAAGATGCTTCCGG - Intergenic
1031772905 7:125868255-125868277 TGTAGATTGTAAGCTGCCTAAGG - Intergenic
1033003269 7:137531065-137531087 TGTACATTCTTTCATGCTTAAGG + Intronic
1034050148 7:147974722-147974744 TGTAAATTGGTACATGCTTTTGG + Intronic
1038136176 8:24788738-24788760 TCTACATTTTTATATGCTTGGGG + Intergenic
1038811892 8:30855885-30855907 AGTACATTAGTAGTTGCTTAGGG + Intronic
1041864458 8:62553854-62553876 TGTACATTTTTAGAAACTTATGG - Intronic
1044084606 8:87928304-87928326 TGTACATTGTTTGAATCATAAGG - Intergenic
1044126790 8:88468892-88468914 TGTACATTTTTAGATGGTGAAGG - Intergenic
1044133430 8:88555822-88555844 TGCATATTGCCAGATGCTTAGGG - Intergenic
1046026910 8:108735384-108735406 AGTAGATTATTAGATGCTCAGGG - Intronic
1047157623 8:122338757-122338779 TGTACATTTTTAGATGGTTGGGG - Intergenic
1055312611 9:74998912-74998934 TGTACATTTTCAGATAATTAGGG - Intronic
1055321883 9:75090121-75090143 TCTGCACTGTTAGATACTTAAGG - Intronic
1056078981 9:83071339-83071361 TGTATTTTGTTAGATGCTTCTGG + Intergenic
1056405760 9:86273269-86273291 TGTACATTGTTAGTTGCCGATGG - Intronic
1056433011 9:86547340-86547362 TGTATATTGCTAGGTGTTTAAGG + Intergenic
1058393803 9:104526189-104526211 TGTACATTGTCAAATGGCTAAGG + Intergenic
1058444486 9:105042695-105042717 TTTGCATTTTTATATGCTTATGG + Intergenic
1059571560 9:115443030-115443052 TTTAAATTGTGAGATCCTTAGGG - Intergenic
1059671087 9:116493248-116493270 GGTACCTTGTTAGGGGCTTATGG + Intronic
1059940195 9:119351570-119351592 TTTGCATTGTTAGGTGCTTTGGG - Intronic
1061430081 9:130525383-130525405 TGTACACTGAAAGATGGTTAAGG + Intergenic
1186907593 X:14128088-14128110 TGTCCATTGTTATATATTTATGG + Intergenic
1187309579 X:18128868-18128890 TGTTCTTTCATAGATGCTTAAGG - Intergenic
1189049252 X:37627184-37627206 TATTCATTGTTTAATGCTTATGG + Intronic
1189387769 X:40551320-40551342 TGCACATTGTTAGGTGCTGCTGG - Intergenic
1196122339 X:112064628-112064650 GATACATTTCTAGATGCTTAGGG - Intronic
1196232852 X:113244417-113244439 TGTGCATTGTTTTTTGCTTATGG + Intergenic
1197907032 X:131436380-131436402 TTTACATGTTTAGATGCTGAAGG + Intergenic
1198025294 X:132699751-132699773 TGGACATTGTGTGATGCTTTAGG - Intronic
1200937509 Y:8751209-8751231 CGAACATTTTTGGATGCTTAGGG + Intergenic
1201746624 Y:17381673-17381695 TGTTCATTCATAGATGGTTATGG + Intergenic