ID: 929307617

View in Genome Browser
Species Human (GRCh38)
Location 2:40381623-40381645
Sequence CATCTGTTCTATAGGACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929307617 Original CRISPR CATCTGTTCTATAGGACAGC TGG (reversed) Intronic
901925138 1:12561349-12561371 CATGTGTTCTGGGGGACAGCTGG + Intergenic
902964482 1:19989421-19989443 CATCAGTTCTACAGGACAATTGG - Intergenic
904368266 1:30031976-30031998 CATCACTTCTATGGGACAGTTGG - Intergenic
906562218 1:46767575-46767597 CATCTGTTCCATAGGAGGGTTGG - Intronic
910402685 1:86853149-86853171 AATCTGTACTATAGTCCAGCAGG + Intergenic
913656022 1:120960601-120960623 CATCAGTTCTATGGGACAATTGG - Intergenic
914520579 1:148411833-148411855 CATCAGTTCTATGGGACAATTGG - Intergenic
915561187 1:156689244-156689266 GATCTGTTCTAGAGGACTGGTGG + Intergenic
915685898 1:157633697-157633719 ATTCTGTTCTATTGGACAGGAGG + Intergenic
917926889 1:179796865-179796887 AAACTGTTCTCTAGGACAGCAGG + Intronic
918642769 1:186863557-186863579 CTGGTGTTCTATAGCACAGCAGG - Intronic
921277120 1:213531608-213531630 CAGCAGTTCTCCAGGACAGCTGG + Intergenic
922126442 1:222730104-222730126 CATCTGTTCTTTAGGAAACTTGG + Exonic
923026602 1:230209364-230209386 CACCTGTCCTGTAGGACAGGTGG - Intronic
1062886937 10:1023740-1023762 CAGCTGTTCAATAGCACAGTAGG + Intronic
1063141572 10:3260478-3260500 CCTATTTTCTATAGGAAAGCTGG + Intergenic
1063810556 10:9700452-9700474 CATCTGTTCTAGGTGATAGCTGG - Intergenic
1068290441 10:54995569-54995591 CATCAGTTCTACGGGACAGTTGG - Intronic
1068409289 10:56634452-56634474 CATCAGCTCTATGGGACAACTGG + Intergenic
1069267149 10:66474137-66474159 CTTCTGTTCTATTGCACAGACGG - Intronic
1069604359 10:69730415-69730437 CCTCTGTTCCAGAGGACTGCTGG - Intergenic
1071056132 10:81510157-81510179 CATCAGCTCTATAGGATAACTGG - Intergenic
1073197456 10:101704607-101704629 CATCTGTTGTGAAGGAGAGCTGG - Intergenic
1073765382 10:106676710-106676732 CATCAGTTCTATGGGACAGTTGG - Intronic
1073951304 10:108812769-108812791 CATCAGTTCTATAGGGAAACTGG + Intergenic
1078840402 11:15072236-15072258 CATCTTTTCTGAAGGAAAGCCGG - Intronic
1079641235 11:22808044-22808066 CATCAGTTCTATGGGACACTTGG + Intronic
1081943415 11:46965083-46965105 CATCAGTTCTATGGGACAAGTGG + Intronic
1083521688 11:63319669-63319691 CATCAGTTCTATGGGACAATTGG + Intronic
1086984943 11:93237563-93237585 CACATGTTTTATAGGAAAGCAGG - Intergenic
1090099563 11:123779695-123779717 CATCAGTTCTATGGGACAATTGG + Intergenic
1094301484 12:28969523-28969545 CATCTGTTCTCCAGGACATCAGG + Intergenic
1094434140 12:30402510-30402532 CATCAGTTCAATAGGACAGTTGG - Intergenic
1097888385 12:64753111-64753133 CTTCTGTTCTATAGGGCGGAAGG - Intronic
1098504985 12:71238908-71238930 CACCTTTTCTATAGGTCAGTGGG + Intronic
1099209773 12:79770024-79770046 CATCTGTCCTAAAGGACTCCAGG - Intergenic
1099699177 12:86062015-86062037 CATCTGTTCCTTAGCAGAGCTGG - Intronic
1100280512 12:93113876-93113898 CATCTGTTCTAAAGGAGCTCAGG - Intergenic
1100291718 12:93221540-93221562 CATCAGTTCTATGGGACAATTGG - Intergenic
1102880169 12:116478782-116478804 CATCAGTTCTATAGGACAATTGG + Intergenic
1104126054 12:125847274-125847296 CATCAGTTCTATGGGACAATTGG - Intergenic
1104651843 12:130540391-130540413 CGTCAGTTCTACAGGACAACTGG - Intronic
1105313830 13:19237966-19237988 GATCTGCTTTATAGCACAGCAGG + Intergenic
1105507249 13:21020825-21020847 CATCTGTGCCACATGACAGCAGG - Intronic
1106972393 13:35157507-35157529 CATCTGTTTTATAGCAAATCTGG + Intronic
1107260832 13:38489150-38489172 CCTCTGTTCTAGAAGTCAGCAGG - Intergenic
1108040604 13:46336149-46336171 CATCTGGTCTATCTGACAGCCGG + Intergenic
1108871567 13:54993315-54993337 CATCAGCTCTATAGGACAACTGG - Intergenic
1109428988 13:62207433-62207455 CATCAATTCTATGGGACAACTGG - Intergenic
1109591903 13:64495720-64495742 CATCAGTTCTATGGGAGAGTTGG - Intergenic
1111349566 13:87009614-87009636 CATCAGTTCTATGGGACAACTGG - Intergenic
1111456633 13:88492956-88492978 CATCAGTTCTATGGGACAATTGG - Intergenic
1111608059 13:90566003-90566025 CATCAGTTCCATGGGACAACTGG - Intergenic
1116389364 14:44374682-44374704 CATCACTTCTATGGGACAGTTGG - Intergenic
1116524991 14:45892886-45892908 GCTCTGTTCTGCAGGACAGCAGG + Intergenic
1118040969 14:61916656-61916678 CCACTGTTCGATAGCACAGCAGG - Intergenic
1123453267 15:20387809-20387831 CATCAGTTCTATAGGACAATTGG + Intergenic
1123908746 15:24945875-24945897 CATCTGTCCCACAGGAAAGCAGG - Intronic
1124486297 15:30120142-30120164 CATCAGTTCTATAGGACAATTGG + Intergenic
1124541372 15:30589127-30589149 CATCAGTTCTATAGGACAATTGG + Intergenic
1124548023 15:30650625-30650647 CATCAGTTCTATAGGACAATTGG + Intronic
1124757286 15:32418460-32418482 CATCAGTTCTATAGGACAATTGG - Intergenic
1125377060 15:39041361-39041383 CATCTGTGCTGTAGGATTGCAGG - Intergenic
1127252233 15:57251593-57251615 CATCTGTTCTTTGGGACATCAGG + Intronic
1130018426 15:80205495-80205517 TATCAGTTCTATGGGACAACTGG - Intergenic
1131400144 15:92118630-92118652 GCTCTCTTCTTTAGGACAGCTGG + Intronic
1131988443 15:98068191-98068213 CATCTGCTCTTTAGGACTGCTGG - Intergenic
1134560122 16:15201774-15201796 CATCAGTTCTATGGGACAATTGG + Intergenic
1134920661 16:18113384-18113406 CATCAGTTCTATGGGACAATTGG + Intergenic
1138656345 16:58493863-58493885 CATCTGTACAACAAGACAGCTGG - Intronic
1142135088 16:88448305-88448327 CATCTGATCTATCAGACATCCGG - Intergenic
1143217667 17:5237237-5237259 CACATGTTCTACAGGACAGAAGG + Intergenic
1143604597 17:7975238-7975260 CATCAGTTCCAAGGGACAGCTGG + Intergenic
1144209647 17:13003499-13003521 CATCTGTGCTTGTGGACAGCAGG - Exonic
1151699032 17:75732784-75732806 CATCTGTAAAATGGGACAGCAGG + Intronic
1153954295 18:10083219-10083241 CATCAGTTCTATGGAACAACTGG + Intergenic
1155689457 18:28600833-28600855 CATCAGTTCTCTGGGACAGTTGG - Intergenic
1156034776 18:32754016-32754038 CATCTGTGCTAGAGAGCAGCAGG - Intronic
1157190917 18:45580970-45580992 CAGTTGTTCTGCAGGACAGCTGG + Intronic
1157712978 18:49862784-49862806 CATCTGTTCTGAATGACAGAGGG + Intronic
1159327248 18:66938211-66938233 CATCAGTTCTATGGGACAATTGG - Intergenic
1159741554 18:72177254-72177276 CATCAGTTCTATGGGACAATTGG + Intergenic
1164388669 19:27797873-27797895 CTTGTGTTCTATATGACAGGTGG - Intergenic
1165185487 19:34017192-34017214 CATTTGTCCTGTATGACAGCAGG + Intergenic
1168538024 19:57187718-57187740 CATCAGTTCTATGGGACAACTGG - Intergenic
1168725645 19:58580396-58580418 CATCTGTTCAATGGGACACTGGG - Intergenic
926482033 2:13411425-13411447 CATCAGTTCTATAGGACAATTGG - Intergenic
928697969 2:33869643-33869665 CATCAGTTCTATGGGACAATTGG + Intergenic
929307617 2:40381623-40381645 CATCTGTTCTATAGGACAGCTGG - Intronic
930086287 2:47499644-47499666 CATCAGTTCTATAGGACAACTGG - Intronic
930975159 2:57449385-57449407 CATCTCTTCTATTGGACAGGAGG + Intergenic
931152704 2:59592650-59592672 CATCAGTTCTATTGGACAATTGG - Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
933544816 2:83696452-83696474 CATCTGTTCTAAAGGGAAGAAGG - Intergenic
933549924 2:83763327-83763349 CATCAGTTCTATGGGACAATTGG + Intergenic
935209678 2:100928402-100928424 CAGCTGTTAAATAGGACAGCTGG + Intronic
935765693 2:106365479-106365501 CATCAGTTCTATGGGACAATTGG + Intergenic
935865199 2:107380541-107380563 CATCAGCTCTATAGGACAACTGG - Intergenic
937919779 2:127120930-127120952 CTTCTGTTCTGTAGGACTGCTGG + Intergenic
938472446 2:131577292-131577314 CTTGTGTTCTATACCACAGCTGG - Intergenic
938708380 2:133953780-133953802 CATCAGTTCTGTGGGACAGTTGG - Intergenic
939961303 2:148568395-148568417 CATCTCTTCTGTAGGTCAGCTGG + Intergenic
943024020 2:182607319-182607341 TATCAGTTCTATAGGACAATTGG + Intergenic
943444008 2:187960206-187960228 CATCAGTTCTATGGGACAATTGG + Intergenic
943551050 2:189339944-189339966 CATCAGTTCTATGGGACAACTGG + Intergenic
945493689 2:210484449-210484471 CATCAGTTCTATGGGACAATTGG - Intronic
945614613 2:212052588-212052610 CATCATTTCTATTGGACAACTGG - Intronic
947483079 2:230521205-230521227 GATCAGTTCTATGGGACAGTTGG - Intronic
948432482 2:237928681-237928703 CATCAGTTCTATGGGACAATCGG + Intergenic
948817216 2:240518120-240518142 CATCAGTTCTATGGGACAATTGG - Intronic
948880457 2:240854664-240854686 CATCCGTTCTATGGGACAATTGG + Intergenic
949071973 2:242030850-242030872 CATCAGTTCTATGGGACAATCGG + Intergenic
1169337867 20:4771934-4771956 CATCAGCTCTATGGGACAACTGG - Intergenic
1170429894 20:16266290-16266312 CATCAGTTCTATGGGACCACTGG + Intergenic
1170812563 20:19686068-19686090 CATCAGTTCTATGGGACAGTTGG + Intronic
1171956169 20:31465477-31465499 CCTGTGTTTTATTGGACAGCAGG + Intergenic
1172573802 20:35991330-35991352 CATATGTTTTTTAGGAGAGCTGG + Intronic
1172719341 20:36987366-36987388 CATCAGTTCTATGGGACAATTGG - Intergenic
1174137725 20:48392421-48392443 CATCAGTTCTATGGGACAATTGG + Intergenic
1178549174 21:33520926-33520948 CATCTGTTCCAGAGGCCAGAAGG + Exonic
1179076677 21:38128827-38128849 CATCAGTTATATAGGAAAGTTGG - Intronic
1179330530 21:40396767-40396789 CATTAATTCTATAGGACAGTTGG - Intronic
1181765773 22:25090898-25090920 CATCTGTCCTATTGGACTGCAGG + Intronic
1182702041 22:32248245-32248267 CATCAGTTCTATGGGACAACTGG - Intronic
950254652 3:11494487-11494509 CATCGGTTCTATGGGACAGCTGG + Intronic
953312480 3:41892580-41892602 CATCAGTTCTATAGGACAATTGG - Intronic
953554467 3:43932522-43932544 GACTTGTTCTATAGGACAGTGGG + Intergenic
953654336 3:44837132-44837154 CATCAGTTCTAGGGGACAGTTGG + Intronic
954892694 3:53945893-53945915 CATCAGTTCTATGGGACAATTGG - Intergenic
955022297 3:55132929-55132951 CCACTGGTCTATAGGACAGTTGG + Intergenic
955249788 3:57268384-57268406 CATCTGTTCTTTAGGATCGTAGG + Exonic
958169707 3:89923173-89923195 CATCAGTTCTCTAGGACAATTGG + Intergenic
959457127 3:106576596-106576618 CATCAGTTATATGGGACAGTTGG - Intergenic
959477798 3:106832574-106832596 CATCAGTTCTATGGGACAACTGG + Intergenic
959504414 3:107142032-107142054 CATCAGTTCTATGGGACAACTGG + Intergenic
961920919 3:130425322-130425344 CCTCTGTTCTAAATGACAACTGG - Intronic
962835087 3:139182855-139182877 CCTCTGTTCTTCAGGAGAGCAGG - Intronic
963398816 3:144770516-144770538 CATCTGATAGACAGGACAGCTGG - Intergenic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
964878911 3:161401579-161401601 CATCTGTTCTCCATGAAAGCTGG + Intergenic
965962843 3:174448995-174449017 CATCAGTTCTATAGGATAATTGG + Intronic
967521885 3:190441401-190441423 CATTTGTTTTATATGACAGTTGG - Intronic
967761767 3:193234059-193234081 CTTCTGTTCTATTGTACAGTAGG - Intergenic
969536089 4:7756859-7756881 TATCTGTCCTATGGGAGAGCAGG + Intergenic
970402864 4:15734806-15734828 CATCACTTCTCTGGGACAGCTGG + Intronic
970926429 4:21457764-21457786 CATGTGATATATAGGACTGCTGG + Intronic
971355645 4:25892971-25892993 CATCTCTGCTACAGCACAGCTGG - Intronic
972791436 4:42375036-42375058 CATCAGTTCTATGGGAAAACTGG - Intergenic
974124334 4:57677129-57677151 CATCAGTTCTATGGGACAATGGG - Intergenic
975398735 4:73909038-73909060 TATCTGTTCAATAAGACAGTTGG + Intergenic
976179522 4:82385974-82385996 CATGTGTTCTATAGGAAGGGAGG + Intergenic
977719005 4:100216992-100217014 CTTCGGTTGTATATGACAGCAGG - Intergenic
978704422 4:111689931-111689953 CATCTTTTATATAGCACAGAAGG + Intergenic
982102096 4:151977966-151977988 CATCAGTTCTATAGGACAACTGG + Intergenic
982186854 4:152811317-152811339 CAGCTGTTATATTGTACAGCTGG + Intronic
982914657 4:161191415-161191437 CATCAGTTATATCAGACAGCAGG - Intergenic
983120203 4:163873928-163873950 CTTATGTTCTATAGGCTAGCTGG + Intronic
983140133 4:164140270-164140292 CATCAATTCTATAGGACAATTGG - Intronic
983869469 4:172808302-172808324 CATCTGTTACATTGGATAGCAGG + Intronic
985245847 4:187979053-187979075 CATCAGTTCTATAAGACAATTGG - Intergenic
988566337 5:32322463-32322485 CATCAGTTTTATAGGACATTTGG + Intergenic
991159665 5:63483365-63483387 CATCAGTTCTATGGGACAATTGG - Intergenic
992308062 5:75464096-75464118 CATCAGTTCTATGGGAAAACTGG + Intronic
992468354 5:77029620-77029642 CATCAGTTCTATAGGACAGTTGG + Intronic
994028135 5:95108618-95108640 CATCTATTATAAAGGAAAGCTGG + Intronic
996037599 5:118775860-118775882 CATCAGTTCTATGGGCCAGTTGG - Intergenic
996915763 5:128710729-128710751 CATCAGTTCTATGGGACAATTGG - Intronic
999454973 5:151707699-151707721 CATCTGTGTTTTAGAACAGCTGG + Intergenic
1001169582 5:169406240-169406262 CTAGTGTTCTATAGCACAGCAGG - Intergenic
1001808643 5:174610137-174610159 CATCTGCCCTCTTGGACAGCAGG - Intergenic
1002473183 5:179449607-179449629 CATCAGTTCTATGGGACAATTGG + Intergenic
1003043368 6:2710297-2710319 CATCAGTTCTGTGGGACAACTGG - Intronic
1005873081 6:29991601-29991623 CTAATGTTCTATAGCACAGCAGG + Intergenic
1008204906 6:48643102-48643124 CATCTGTTCTATGGGACAACAGG - Intergenic
1008556001 6:52673299-52673321 CCCCTGTTCTATGGGACAGGTGG - Intronic
1010989278 6:82461505-82461527 CATCAGTTCTATGGGACAGTTGG - Intergenic
1011388426 6:86822963-86822985 CTTCTTATCTATAGGACAGAAGG + Intergenic
1012233614 6:96787885-96787907 CATCAGTTATATGGGACAGTTGG - Intergenic
1012368758 6:98477190-98477212 CATCAGCTCTATGGGACAGTGGG - Intergenic
1013076851 6:106779489-106779511 CATCAGTTCTATGGGACAATTGG + Intergenic
1015934447 6:138394455-138394477 CATCAGTTCTATGGCACAGTTGG + Intergenic
1016009052 6:139119650-139119672 CATCTGTTCCATGGGACAACTGG - Intergenic
1017141697 6:151196750-151196772 CAGCTGTTCTGTGGGCCAGCTGG - Intergenic
1017734236 6:157346430-157346452 CATCAATTTTATAGGAAAGCTGG + Intergenic
1018624210 6:165761926-165761948 CATCAGTTCTATGGGACAATAGG - Intronic
1020581092 7:10003435-10003457 CATCAGTTCTATGGGACAATAGG - Intergenic
1024001584 7:45193295-45193317 CATCAGTTCTATGGGACAATTGG + Intergenic
1024212864 7:47221154-47221176 CAGATGTTGTATATGACAGCTGG - Intergenic
1024858883 7:53814607-53814629 CACCTATTTTGTAGGACAGCAGG - Intergenic
1025083850 7:56006814-56006836 CAGCTGTTAAAGAGGACAGCAGG + Intergenic
1026517404 7:71084777-71084799 AATGTGTTCTATAAGACAGATGG - Intergenic
1027625860 7:80544163-80544185 CATCAGTTCTATGGAACAGTTGG + Intronic
1028668529 7:93373818-93373840 CTGCTGTTCTATAGCACAGTAGG + Intergenic
1033861397 7:145632423-145632445 CTTCTGTTCTAGAGGGCAGTAGG + Intergenic
1034180195 7:149131159-149131181 CATCAGTTCTATAGGGCAATTGG + Intronic
1034233112 7:149548065-149548087 CATCAGTTCTATGGGACAATTGG - Intergenic
1034327916 7:150254382-150254404 CATCAGTTCTATAGGACAATTGG - Intronic
1034765294 7:153715056-153715078 CATCAGTTCTATAGGACAATTGG + Intergenic
1038214174 8:25546496-25546518 CATCAGTTCTATGGGACAATTGG + Intergenic
1038231688 8:25706479-25706501 CATTAGTTCTATGGGACAACTGG - Intergenic
1038911826 8:31973485-31973507 CATCTATTCTGTAAGAGAGCTGG - Intronic
1038919597 8:32068109-32068131 CATTTGTTCTACAGGTCAGAAGG + Intronic
1039287015 8:36052743-36052765 CATCAGTTCCATGGGACAGTTGG + Intergenic
1039389719 8:37168390-37168412 CATCAGTTCTATGGGACATTTGG + Intergenic
1040410583 8:47150412-47150434 CTTGTGTTCTATACCACAGCTGG + Intergenic
1052176996 9:25474183-25474205 CATCAGTTCTATGGGACAATTGG - Intergenic
1052227127 9:26103397-26103419 CATCTGTTCTATAGGGTCTCAGG - Intronic
1052561712 9:30091747-30091769 CATCAGTTCTGTGGGACAGTTGG - Intergenic
1055000953 9:71447868-71447890 CTTCTGCTCATTAGGACAGCCGG + Intergenic
1055367919 9:75565462-75565484 CATCAGTTCTATGGGACAATTGG + Intergenic
1056224239 9:84479924-84479946 CATCTGCTAAATAGGACACCAGG - Intergenic
1057765319 9:97911742-97911764 CATCTGTCCAGTGGGACAGCTGG - Intronic
1057857524 9:98612952-98612974 CCTCTGCTCTAGAGGAAAGCTGG + Intronic
1060387974 9:123250814-123250836 GATCTGTTTTAAAGGAAAGCAGG + Intronic
1188182877 X:27077022-27077044 CATCAGTTCTATGGGACAATTGG - Intergenic
1189407566 X:40738826-40738848 CATCGGTTCTATGGGACAATTGG - Intergenic
1195472493 X:105246786-105246808 CATCAGTTATATAGGACAACTGG + Intronic
1201990400 Y:20017821-20017843 CATATGTTCTCTTGTACAGCTGG - Intergenic