ID: 929311901

View in Genome Browser
Species Human (GRCh38)
Location 2:40435264-40435286
Sequence GGAAGTGCTTGCCTTGGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929311901_929311905 17 Left 929311901 2:40435264-40435286 CCACTACCAAGGCAAGCACTTCC 0: 1
1: 0
2: 1
3: 11
4: 184
Right 929311905 2:40435304-40435326 GAGATGATGCCAGAGGATGAAGG 0: 1
1: 0
2: 1
3: 25
4: 339
929311901_929311904 10 Left 929311901 2:40435264-40435286 CCACTACCAAGGCAAGCACTTCC 0: 1
1: 0
2: 1
3: 11
4: 184
Right 929311904 2:40435297-40435319 AGACAAAGAGATGATGCCAGAGG 0: 1
1: 0
2: 2
3: 33
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929311901 Original CRISPR GGAAGTGCTTGCCTTGGTAG TGG (reversed) Intronic
900011339 1:112218-112240 GGAAGAGCTTGTCTTGGTCCAGG - Intergenic
900027443 1:288784-288806 GGAAGAGCTTGTCTTGGTCCAGG - Intergenic
900041398 1:468226-468248 GGAAGAGCTTGTCTTGGTCCAGG - Intergenic
900062832 1:703203-703225 GGAAGAGCTTGTCTTGGTCCAGG - Intergenic
900177081 1:1295686-1295708 GGAGGGGCTTGCCTTGGTCGGGG - Intronic
901508618 1:9702477-9702499 GAAAGTTCTTTCCTTGGAAGTGG - Intronic
901655529 1:10767268-10767290 GGAGATGCCTGCCTGGGTAGAGG - Intronic
902729832 1:18362167-18362189 TGAAGTTCTGGGCTTGGTAGCGG - Exonic
903654511 1:24941172-24941194 AGAAGTGCTTACCTAGGTGGGGG - Intronic
906398843 1:45490406-45490428 GGAATTGTTTTCCTGGGTAGAGG + Intronic
906850411 1:49243222-49243244 TATAGTGCTTGCCTTGGTATTGG + Intronic
907356579 1:53879943-53879965 GGGAATGCTTTCCTTGGTTGGGG - Intronic
922259778 1:223928228-223928250 GGAAGAGCTTGTCTTGGTCCAGG - Intergenic
922437636 1:225621876-225621898 AGAAGTATTTGCCTTGGAAGAGG + Intronic
922614137 1:226951189-226951211 GTCAGTGCTTGCCTTGCAAGGGG + Intronic
922794003 1:228329988-228330010 GAAAGTTCTTGCCTCAGTAGTGG - Intronic
924292293 1:242548977-242548999 GGAAATGATTGCCTTGGGTGGGG - Intergenic
924340942 1:243030790-243030812 GGAAGAGCTTGTCTTGGTCCAGG - Intergenic
1063214808 10:3914675-3914697 GGAAGTGCTTGCCTTGGTCCTGG + Intergenic
1064570702 10:16689941-16689963 GGAAATGCTTCCCTTGAAAGAGG - Intronic
1065225846 10:23543094-23543116 GGAAGTGGTTGTCTTTGGAGAGG - Intergenic
1066735528 10:38474631-38474653 GGAAGAGCTTGTCTTGGTCCAGG + Intergenic
1069676745 10:70254175-70254197 GTAAGTTCTTGCCTTGGTCTGGG + Exonic
1069785332 10:70984184-70984206 GGAAGCTATGGCCTTGGTAGAGG + Intergenic
1070243867 10:74711572-74711594 AGCAGTGGTTGCCTTTGTAGGGG + Intergenic
1070503295 10:77091287-77091309 GGAATTGCTCGCCTTGTTTGAGG + Intronic
1071215746 10:83399046-83399068 GGAAGTGCGGGACTTGGGAGAGG - Intergenic
1075811195 10:125226389-125226411 GGAAGAGAAGGCCTTGGTAGAGG + Intergenic
1076967672 11:104454-104476 GGAAGAGCTTGTCTTGGTCCAGG - Intergenic
1077037440 11:502295-502317 GGAAGTGTTTGCCCAGGGAGAGG - Exonic
1078068521 11:8093626-8093648 TGGAGTGCTTGCCCTGGTTGTGG + Intronic
1079129206 11:17737762-17737784 GGCAGTGCTTTGCCTGGTAGGGG - Intronic
1081192296 11:40118996-40119018 GGAAGTGCTGGCCTTGAAACTGG - Intronic
1082802687 11:57426265-57426287 GGAAGGGCTTGGCTTGCCAGAGG - Exonic
1097120038 12:56724705-56724727 GGAATTGCTGGCCTTGATAGAGG - Intronic
1097510144 12:60529208-60529230 GAAAATGCTTGTCTTGGGAGAGG + Intergenic
1099557861 12:84132564-84132586 GGAAGTGCTAGCCTTTTTAATGG - Intergenic
1100706478 12:97205317-97205339 TGTAGTGCTTGGCTTTGTAGTGG - Intergenic
1101718112 12:107328864-107328886 GGCGGGGCTTGCCTTGGTGGTGG + Intronic
1102957044 12:117065479-117065501 GGAGGTGCTTGCTTTGAAAGGGG + Intronic
1111485600 13:88895423-88895445 GGAAGGGCGTGGCTTGGAAGGGG - Intergenic
1111856795 13:93647967-93647989 GGGAGTGTTTGCCTTGGAATGGG + Intronic
1114209301 14:20601738-20601760 CGAGGTGCTTGGCTTGGTGGGGG + Intronic
1119930644 14:78542873-78542895 TGGAGTGCTTGAGTTGGTAGGGG + Intronic
1120853207 14:89189300-89189322 GGAAGTCCCTGCCTTTGGAGTGG - Intronic
1121917187 14:97846082-97846104 GGTAGTGCTTGTTTTGGTAGTGG + Intergenic
1123100150 14:105792106-105792128 GGAGGTGCTTGCTCTTGTAGGGG + Intergenic
1125798280 15:42420814-42420836 GGAAGTGCTTATTTTGGTAATGG - Intronic
1127744444 15:61952203-61952225 GAAAGAGCTTGCCTTAGGAGTGG - Intronic
1128012905 15:64315526-64315548 GGAATTACTTGCCTTAGTAAAGG + Intronic
1131468979 15:92679425-92679447 GGAAGTGATTCCTTGGGTAGGGG - Intronic
1132693693 16:1192841-1192863 GAAATTGCCTGCTTTGGTAGTGG + Intronic
1133216098 16:4293463-4293485 AGAAGTGCAGGCCCTGGTAGTGG - Intergenic
1133253857 16:4504047-4504069 GGATGAGCTTGCCTTGTTATGGG + Intronic
1135288441 16:21214059-21214081 GGAAGTTTTTGCCTTGGAAAGGG + Intronic
1138050527 16:53772255-53772277 GGAAGCACTTGCCCTGTTAGAGG - Intronic
1140986204 16:80160174-80160196 GTCAGTGGTTTCCTTGGTAGGGG + Intergenic
1142453009 16:90194685-90194707 GGAAGAGCTTGTCTTGGTCCAGG + Intergenic
1144293196 17:13846277-13846299 GGAAGTCCATGCCTTGGTTTAGG - Intergenic
1148806525 17:50266734-50266756 GGCAGTGCTAGCCTTGGAGGAGG + Intergenic
1148934641 17:51155153-51155175 AGAATTGCTTGCCTGGGAAGTGG + Intronic
1152254924 17:79233327-79233349 GTCAGTGCTTGCCTTGGAAGAGG + Intronic
1155283250 18:24262792-24262814 AGCAGTGGTTGCCTGGGTAGGGG - Intronic
1156451790 18:37270756-37270778 AGATGTGCTTACCTGGGTAGGGG + Exonic
1156731820 18:40203517-40203539 GGAAGAGGTTTCCTAGGTAGTGG - Intergenic
1157783228 18:50458463-50458485 TGAAGTGCTTGACATGGCAGAGG + Intergenic
1158165528 18:54535402-54535424 GGACGTGCCTGCATTTGTAGTGG - Intergenic
1158428936 18:57366220-57366242 GGAAATGCTTCCCTTGGTGGAGG - Exonic
1160644476 19:174077-174099 GGAAGAGCTTGTCTTGGTCCAGG - Intergenic
1161951814 19:7471714-7471736 GGAAGTGCTCCCCTGGGCAGAGG + Exonic
1162187227 19:8915053-8915075 GGCAGGGCTGGCCTTGGTGGGGG + Intronic
1167136376 19:47618635-47618657 TGAAGTGCTTGCCTGTTTAGGGG + Intronic
1167608651 19:50495404-50495426 TGTAGTCCTTGCCTTGGAAGAGG + Intergenic
1167661411 19:50798062-50798084 GGAAGTGCGGGACATGGTAGGGG - Exonic
1167804100 19:51767473-51767495 GCAAGGGATTGCTTTGGTAGTGG - Intronic
1168309523 19:55453319-55453341 GGGAGTTCTGGCCTTGGAAGAGG + Exonic
925328158 2:3038778-3038800 GGACGTGCTTCCCGAGGTAGAGG + Intergenic
925726643 2:6879031-6879053 GCAAGTGCTTACCAGGGTAGTGG - Intronic
927810074 2:26175669-26175691 GGAAGGGCTGCCCTTGGGAGAGG + Intronic
927846520 2:26475145-26475167 GGATGTGCTGGCCTGGGAAGGGG + Intronic
929311901 2:40435264-40435286 GGAAGTGCTTGCCTTGGTAGTGG - Intronic
929779325 2:44947591-44947613 GGAAGGGCCTGCCTAGATAGAGG + Intergenic
931801698 2:65765227-65765249 GGAATTGCTAGCCCTGGGAGAGG - Intergenic
932239600 2:70146345-70146367 GCCCGTGCTTGACTTGGTAGAGG + Intergenic
934907594 2:98218932-98218954 GGAGGGTCTTGCCTCGGTAGTGG + Intronic
937671965 2:124547636-124547658 GTAAGTGCTTGCCTTGGCCAGGG + Intronic
938187971 2:129250148-129250170 GGAAGTGAGTGACTTGGTATTGG - Intergenic
940317565 2:152341050-152341072 GCAAGTGCTTTCCTTGGAAGTGG - Intronic
942384337 2:175425307-175425329 GGAAGAGCTTGCCTCAGCAGTGG + Intergenic
942847963 2:180448567-180448589 GGAAGTCCCTGCCATGATAGAGG + Intergenic
945277250 2:208000376-208000398 GGAAGGGCTTGGCTTGCAAGGGG - Intronic
945318273 2:208393509-208393531 GGAACTGCTTCCCTTCCTAGTGG + Intronic
947481574 2:230505293-230505315 TGAGGTGCTTGCCCTTGTAGTGG - Intronic
949084449 2:242139348-242139370 GGAAGAGCTTGTCTTGGTCCAGG + Intergenic
1170290110 20:14760023-14760045 GGAAGTGCTTACCTGGGCATTGG + Intronic
1170792545 20:19520125-19520147 ACAAGAGCTTGCCTTGGTATGGG - Intronic
1170996432 20:21364436-21364458 GGTAGTGATAGCCGTGGTAGTGG - Intronic
1173031852 20:39368424-39368446 GGAACTGCTTCCCTTGGAGGAGG - Intergenic
1174485215 20:50856654-50856676 GGAAGTGTGTGCATTGGTACGGG + Intronic
1175789520 20:61732646-61732668 GGACGTGCCTGGCTAGGTAGGGG - Intronic
1176281031 20:64311831-64311853 GGAAGAGCTTGTCTTGGTCCAGG + Intergenic
1177075591 21:16568415-16568437 GGAAATGCTTATCTTGGGAGTGG + Intergenic
1178701521 21:34837294-34837316 GAACGTTATTGCCTTGGTAGGGG + Intronic
1180884756 22:19233751-19233773 AGAAGCAGTTGCCTTGGTAGAGG - Intronic
1183538308 22:38415798-38415820 GGGAGGGCCTGCCCTGGTAGAGG - Intergenic
1185236250 22:49715090-49715112 GGCAGTGGTTGCCTGGGGAGGGG + Intergenic
950572001 3:13807051-13807073 GGAAGGTCTTGCCTCAGTAGTGG - Intergenic
950778664 3:15372688-15372710 GGCAGTGATTGTCGTGGTAGTGG - Intergenic
953322705 3:41986558-41986580 AACAGTGCTTGCCTTGTTAGAGG + Intergenic
954923372 3:54211261-54211283 GGAAGTGTTTGCTTTGATATTGG - Intronic
955146241 3:56322904-56322926 GGAAGTGTTTGGGTTGGTGGGGG + Intronic
955419239 3:58720383-58720405 GGAAGTGATGGCCTTGATACAGG + Intronic
956395071 3:68816926-68816948 GGAAGGTCTTGCCTTGATATTGG + Intronic
956626190 3:71269041-71269063 GGAAGGGCCTGCATGGGTAGTGG - Intronic
956730265 3:72190055-72190077 GAAAGTGCTTGTCTTGAAAGAGG - Intergenic
957223798 3:77416306-77416328 GGAAGTTCTTACTCTGGTAGTGG + Intronic
958782065 3:98554705-98554727 GCAAGTGTTTGGCTTGGTAATGG - Intronic
958896628 3:99836765-99836787 GGGAGTGATTGGCTTGCTAGGGG + Intronic
959005258 3:101012530-101012552 GGAATTGCTTTCCTGGGGAGCGG - Intergenic
960044781 3:113186243-113186265 GGAAGTGCTAGGCTTGGTAAAGG + Intergenic
960511977 3:118560925-118560947 GGACGTCCTTGCCTTGCTTGCGG + Intergenic
962346002 3:134619447-134619469 GGAAGAGCAGGCCTTGGCAGAGG + Intronic
963508747 3:146221705-146221727 GCAAGGTCCTGCCTTGGTAGAGG - Intronic
970471540 4:16384377-16384399 ATAAGTGAGTGCCTTGGTAGAGG - Intergenic
971017166 4:22500210-22500232 TTAAGTGCTTTCTTTGGTAGTGG - Intronic
974348534 4:60714685-60714707 GAAATTGTTTGCCTTGGGAGGGG - Intergenic
974439187 4:61895105-61895127 GTTAGTGCTTGACTTTGTAGAGG - Intronic
975271555 4:72441077-72441099 GGAAGTGGTTGCCTGGGGAAGGG - Intronic
978807743 4:112818313-112818335 GGAAGTGTTTGTGTTGATAGGGG + Intronic
979261881 4:118657586-118657608 GGAAGAGCTTGTCTTGGTCCAGG + Intergenic
980058531 4:128103436-128103458 TGAATTACCTGCCTTGGTAGTGG + Intronic
982047040 4:151458442-151458464 GGAAGTGATTTCTTTGGTAGAGG + Intronic
983149945 4:164265736-164265758 GGAAGAGCTTGTCTTGGTCCAGG - Intronic
983408475 4:167364391-167364413 TGAAATGCTTGCCTTGTTAGGGG - Intergenic
983412368 4:167417390-167417412 GGAACTGCTTCCCTTACTAGTGG - Intergenic
985083625 4:186291756-186291778 GGAAGTGTTGGCCCTGGAAGTGG + Intergenic
985099998 4:186449230-186449252 CAAAGTGGTTGCTTTGGTAGAGG + Intronic
986222647 5:5782681-5782703 GCAAGTGCTTCCCATGGGAGTGG - Intergenic
990744264 5:58942803-58942825 GGTCTTGCTTGCCTTGCTAGTGG - Intergenic
990777105 5:59314979-59315001 GGAAGTTCATGCCTTGTTGGGGG + Intronic
991438050 5:66616293-66616315 TGAACTGCTCACCTTGGTAGGGG - Intronic
991590393 5:68245623-68245645 TGAAATCCTTGGCTTGGTAGAGG - Intronic
992663862 5:78986390-78986412 GAAACTGTTTTCCTTGGTAGTGG - Intergenic
998477192 5:142431950-142431972 GGAAGTGTTTGGCCTGGTTGAGG + Intergenic
999280719 5:150363657-150363679 GGCAGAGCATGCCTTGGAAGAGG + Intronic
1000232643 5:159330420-159330442 GGAAGTGCTTACCTTGCTCTGGG + Exonic
1001680801 5:173555534-173555556 GACAGTTCTTGCCTTGGCAGGGG - Intergenic
1002044626 5:176535008-176535030 GGGAGTGGGTGCCTTTGTAGGGG - Intronic
1002732448 5:181350702-181350724 GGAAGAGCTTGTCTTGGTCCAGG + Intergenic
1002752091 6:123404-123426 GGAAGAGCTTGTCTTGGTCCAGG - Intergenic
1002869366 6:1152214-1152236 GAAATTGCTGGCCTGGGTAGTGG + Intergenic
1003406874 6:5833471-5833493 AGAAGAGCCTGCCTTGGTTGGGG + Intergenic
1004557845 6:16717000-16717022 GGAAGAGATTGCCTAGTTAGCGG + Intronic
1006129266 6:31859560-31859582 GGAAGTGATTTCCCTGGTAAAGG + Exonic
1006690211 6:35877187-35877209 GGAAGGTCTTGCCTCAGTAGAGG + Intronic
1013559917 6:111293710-111293732 GGGAGTGGTTACCTTGGTGGCGG - Intergenic
1014198251 6:118582530-118582552 GGAACTGCTTCCCTTCCTAGTGG - Intronic
1014674713 6:124349295-124349317 GGAAGTTCCCGCCTTTGTAGGGG - Intronic
1016318159 6:142812381-142812403 GAAAGGTCTTGCCTTGATAGTGG + Intronic
1018666204 6:166140760-166140782 GGAAATGCTTTCCTGGGGAGTGG - Intergenic
1019236700 6:170623018-170623040 GGAAGAGCTTGTCTTGGTCCAGG + Intergenic
1020276696 7:6628823-6628845 GGAATTTCTTGCCCTGGTGGGGG + Intergenic
1022876236 7:34533573-34533595 GGAAGTGGCTGCCTTTGCAGAGG - Intergenic
1024097334 7:45993254-45993276 AGAGGAGATTGCCTTGGTAGTGG - Intergenic
1027570504 7:79860145-79860167 GGAGGTGTTTGGCTTGGGAGTGG + Intergenic
1030082541 7:105790125-105790147 GTAAGTGCTTGCCTTGGGTTGGG + Intronic
1030646890 7:112071739-112071761 GGATGTCCTTGCCTTAGCAGAGG + Intronic
1031062203 7:117064821-117064843 GGAAGTGCGTGCCATGGAACAGG + Intronic
1032778963 7:135146796-135146818 GAAAGTGCTTGCCTCTGAAGAGG + Intronic
1035511072 8:183590-183612 GGAAGAGCTTGTCTTGGTCCAGG - Intergenic
1036805388 8:11828470-11828492 GGCAGTGGCTGCCTTGGAAGTGG + Intronic
1037902015 8:22694022-22694044 GGGAGTGCTTCCCTTTGTGGGGG + Intergenic
1041866216 8:62576750-62576772 GGAGATGCTAGCCTTGGTTGAGG - Intronic
1041978037 8:63821649-63821671 GGAAGTGATTGCTTTAGTGGTGG + Intergenic
1044252235 8:90017253-90017275 GGAGGTACTGGCCTTGGTAAAGG + Exonic
1044829251 8:96230025-96230047 TGAAATGCTTTCTTTGGTAGAGG - Intronic
1046077322 8:109328649-109328671 GGAAAGTCTTGCCTCGGTAGTGG + Intronic
1046932743 8:119856994-119857016 GGCAGTGCTTTCGTTGGTGGTGG + Intergenic
1048389386 8:133947299-133947321 GGATGTGGCTGCCTTGGTGGAGG - Intergenic
1048831023 8:138477673-138477695 GGAAGTGCCTGTCTGGGTATAGG - Intronic
1054792365 9:69268048-69268070 GGATGTGCCTGCCTTGCTAGTGG + Intergenic
1055858339 9:80718812-80718834 GGAAGTTCTTGCAATGATAGAGG - Intergenic
1057384033 9:94591962-94591984 GGCAGTGGCTGCCATGGTAGGGG - Intronic
1059155138 9:111982788-111982810 GGATGTGCTAGTCCTGGTAGAGG - Intergenic
1059688097 9:116657176-116657198 AGAAGTGCAGGCCTTGCTAGTGG - Intronic
1062225478 9:135447232-135447254 GGAAGGGCTGGCCGTGGCAGGGG + Intergenic
1062456217 9:136640504-136640526 GGAAGGGCTTGCCTCGGCGGGGG - Intergenic
1062578822 9:137220951-137220973 GGACATGCCTGCCTTGGAAGGGG - Exonic
1062756850 9:138303029-138303051 GGAAGAGCTTGTCTTGGTCCAGG + Intergenic
1186152851 X:6693334-6693356 GGAAGTTCATGCCATGGTTGGGG + Intergenic
1187069840 X:15877575-15877597 GGAACTGCTTGACTTGGTCTGGG + Intergenic
1188245366 X:27831088-27831110 GGAAGTGAATGCCTTGGAATGGG + Intergenic
1189610424 X:42727560-42727582 GGAAGTTCTTGCCTCAGTAGTGG + Intergenic
1196757560 X:119171255-119171277 GGAAAAGCTGGCCTTGGCAGTGG + Intergenic
1199550410 X:149055904-149055926 GGAGGAGCTTGCCTTAGCAGAGG - Intergenic
1202383969 Y:24306051-24306073 GGAAGAGCTTGTCTTGGTCCAGG + Intergenic
1202486814 Y:25364069-25364091 GGAAGAGCTTGTCTTGGTCCAGG - Intergenic