ID: 929317498

View in Genome Browser
Species Human (GRCh38)
Location 2:40497493-40497515
Sequence TAAATCAGTATTGGGTAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929317484_929317498 26 Left 929317484 2:40497444-40497466 CCATTACAGAGATATCCACAGGG 0: 1
1: 0
2: 1
3: 10
4: 141
Right 929317498 2:40497493-40497515 TAAATCAGTATTGGGTAAGGGGG 0: 1
1: 0
2: 1
3: 10
4: 159
929317490_929317498 11 Left 929317490 2:40497459-40497481 CCACAGGGGGCAGTGGGAGCAGA 0: 1
1: 0
2: 2
3: 52
4: 417
Right 929317498 2:40497493-40497515 TAAATCAGTATTGGGTAAGGGGG 0: 1
1: 0
2: 1
3: 10
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929317498 Original CRISPR TAAATCAGTATTGGGTAAGG GGG Intronic
904705234 1:32385282-32385304 AAAAACAGTATTGGGGGAGGGGG + Intronic
906701873 1:47865363-47865385 TAAATCAGTACTGCGAGAGGTGG - Intronic
906809747 1:48813735-48813757 TGGAGCAGAATTGGGTAAGGTGG + Intronic
908778571 1:67666981-67667003 TAAATCATTAATAGGTAAAGTGG + Intergenic
908903659 1:68984062-68984084 TAAATCAGGATTGCTAAAGGTGG + Intergenic
909910048 1:81248136-81248158 TAAAAGAGTATTGTGTAAGTTGG - Intergenic
910325816 1:86005474-86005496 TAAATAATTATTGGGTGAGAAGG + Intronic
914908676 1:151767496-151767518 AAAATCAGGATTGGGAAAAGAGG + Intronic
918527753 1:185483567-185483589 TGAATCCTTATTGGGTAAGTGGG + Intergenic
919017550 1:192059519-192059541 TAAATCAGATTTGTGTTAGGTGG + Intergenic
919632592 1:199973515-199973537 CAAAACAGCATAGGGTAAGGAGG + Intergenic
921226286 1:213023197-213023219 TTAATAAGAATTGGGTAGGGAGG + Intergenic
921531139 1:216284574-216284596 TAAATCAGTACTGGGTAGTGGGG + Intronic
1062777038 10:160009-160031 CAAAGCAGTATTGAGTAAGAAGG + Intronic
1064241981 10:13638910-13638932 GAGAACAGTATTGGGTAAGTTGG + Intronic
1064273782 10:13888430-13888452 AGAATCAGAAATGGGTAAGGTGG + Intronic
1064998908 10:21319602-21319624 TAAAAGAGCATTGTGTAAGGAGG - Intergenic
1067867865 10:49927577-49927599 AAAATAAGAATTGGCTAAGGAGG + Intronic
1071961200 10:90810118-90810140 TAAAAGAGTATTGTCTAAGGTGG - Intronic
1073922228 10:108471830-108471852 TAAATTGGTACTGGGTAAGGGGG - Intergenic
1075839787 10:125491174-125491196 TAAATCAGTATTTGGTAAGAAGG + Intergenic
1084841525 11:71855209-71855231 TAAATTTGTTTTGGGTAAGTTGG + Intergenic
1087285719 11:96263156-96263178 TAAATCAGAATTGATTAAAGAGG - Intronic
1088717521 11:112561781-112561803 AAAACCAATATAGGGTAAGGTGG - Intergenic
1089024418 11:115254177-115254199 TAATACAGTATTGGCTAAGAGGG + Intronic
1089778111 11:120853294-120853316 TAAAGGAGTATTCGGTGAGGGGG + Intronic
1090592055 11:128282645-128282667 TAATTCAGTATTCAGTAATGTGG + Intergenic
1091002075 11:131918135-131918157 ATAATCAGTCTTGCGTAAGGAGG + Intronic
1093258830 12:16907844-16907866 GAAATCAGTAATGGGAAAGATGG + Intergenic
1093296469 12:17398190-17398212 TAAAGCAGGAATGGGTAAGTGGG + Intergenic
1097624986 12:61989324-61989346 TAAACCTTTTTTGGGTAAGGAGG - Intronic
1098629948 12:72711916-72711938 TAAATGAGTATTGTCTAAGTTGG + Intergenic
1099228355 12:79995005-79995027 TAATTCAGTATAGCGTGAGGTGG - Intergenic
1099296198 12:80830951-80830973 TTAATCAGTACAGCGTAAGGAGG - Intronic
1100390386 12:94141748-94141770 GCAATCAGTCTTGGGTGAGGTGG + Intergenic
1106840870 13:33683864-33683886 CAAATCAGTACTGGGCATGGTGG + Intergenic
1108768282 13:53662646-53662668 AAAATCAGTATTGGGATAGTGGG + Intergenic
1109482872 13:62979305-62979327 TAAATCAATACAGAGTAAGGTGG - Intergenic
1109740683 13:66550744-66550766 CAAATCTGTATTAGGTAAGAGGG - Intronic
1109755831 13:66758793-66758815 TAGATCAGTAAGGAGTAAGGGGG - Intronic
1109911682 13:68920513-68920535 TAAAACAATATTTTGTAAGGAGG - Intergenic
1110208810 13:72948595-72948617 TAAATCAGTACTGGGTAGTGGGG - Intronic
1113186992 13:107699214-107699236 TCAATAAATATTGGGTTAGGAGG - Intronic
1113190865 13:107743946-107743968 TAGATTAGAATTGGGAAAGGGGG + Intronic
1114821247 14:26021692-26021714 TAAATCATCATGGTGTAAGGAGG + Intergenic
1115051964 14:29073501-29073523 TAAATTCGTACTGGGTAATGAGG - Intergenic
1117068327 14:52032889-52032911 TAAATCAGTATTGAGTAATTAGG - Intronic
1121184285 14:91953134-91953156 TAAATCAGAGCTGGGCAAGGTGG + Intergenic
1121872794 14:97425010-97425032 GAAAACATTCTTGGGTAAGGGGG - Intergenic
1124352887 15:28971228-28971250 TTAATCACGATTGGATAAGGGGG + Intronic
1126300787 15:47194037-47194059 TAAATAAATATTGGGTGAGTGGG + Intronic
1131318803 15:91366737-91366759 TCCATGAGAATTGGGTAAGGAGG + Intergenic
1134834880 16:17352895-17352917 TAAATCACTATTGGGCCATGTGG - Intronic
1140966746 16:79973806-79973828 TAAATTAGTCTGGGGTGAGGTGG - Intergenic
1151133401 17:71921880-71921902 TACAGCAGTGTTGGGTTAGGTGG - Intergenic
1151307543 17:73272937-73272959 TAAATAATTATTGGGTCATGAGG + Intergenic
1158977184 18:62720620-62720642 TACAGCAGTATTGAGTAACGCGG + Intronic
1160358997 18:78254912-78254934 TAAATCAGTTTTGAGTAAAGCGG - Intergenic
1161195311 19:2983230-2983252 TACAACAGTATTTGGCAAGGAGG - Intronic
927448336 2:23185340-23185362 TAAATCAGTATTACCTAGGGAGG + Intergenic
928770740 2:34700108-34700130 TAAAAGAGTATTGGCTAAGTTGG + Intergenic
928857256 2:35815779-35815801 TAAAAGAGTATTGGCTAAGTTGG - Intergenic
929317498 2:40497493-40497515 TAAATCAGTATTGGGTAAGGGGG + Intronic
929718904 2:44345852-44345874 TAAATCAGTGCTGGGCATGGTGG + Intronic
930639124 2:53837413-53837435 TAAATCAGGACTGGGCACGGTGG - Intergenic
930822285 2:55658606-55658628 TAGCTGATTATTGGGTAAGGGGG - Intronic
930964347 2:57303178-57303200 TACATTAGTATGGGGGAAGGGGG - Intergenic
932221189 2:70000193-70000215 TATATGAGAATTGGGCAAGGTGG + Intergenic
934929779 2:98412425-98412447 TATATAAGTGCTGGGTAAGGAGG + Intergenic
935455512 2:103262922-103262944 TGTTTCAGTATTAGGTAAGGAGG + Intergenic
938120204 2:128627670-128627692 ACAATCAGTCTGGGGTAAGGAGG - Intergenic
940135010 2:150425767-150425789 TAAATTAATATTGTGAAAGGAGG - Intergenic
940547276 2:155103316-155103338 TAAATTGGTATTGGGTAGTGGGG - Intergenic
940806125 2:158188509-158188531 TAAATCAGTACTGGGGAAACTGG + Intronic
941296259 2:163742021-163742043 TAAAACAGCATTAGGTTAGGTGG + Intergenic
1172382853 20:34511406-34511428 TCTATCAGTCTTGGGTAAGGAGG + Intergenic
1173628971 20:44495671-44495693 CAAACCAGTACTGTGTAAGGAGG - Intergenic
1177080740 21:16635601-16635623 CAAATCAGCATGGGGTAAGTTGG + Intergenic
1178014359 21:28326540-28326562 TAAATCAGCATGAGCTAAGGTGG + Intergenic
1178098898 21:29244736-29244758 TAAATCAGTTTTGTTAAAGGTGG + Intronic
1181754271 22:25012017-25012039 TAAATCAGAATTGGGTCACATGG + Intronic
1181841541 22:25666958-25666980 TTATTCAGTAATGGGTAAAGTGG + Intronic
950828685 3:15852986-15853008 TAAATCAGTATCGCTTAAGGAGG + Intronic
951443797 3:22753339-22753361 AAAATCAGAATTTGGAAAGGGGG + Intergenic
951899379 3:27641968-27641990 TAAGGCAGTATTTAGTAAGGCGG - Intergenic
953043082 3:39272239-39272261 TAACTGAATAGTGGGTAAGGAGG - Intronic
957334823 3:78814214-78814236 TATATCAATATTGGGCAATGTGG - Intronic
957709220 3:83833282-83833304 TAAATCAATAATGGATATGGAGG + Intergenic
957834486 3:85569138-85569160 GAAATCAGGATTGGGTGTGGAGG - Intronic
958836131 3:99147514-99147536 TAAATTGGTATTGGGTAGTGGGG + Intergenic
960281980 3:115790557-115790579 TAAGACAGAATTGGGTAAGTAGG + Intergenic
960713829 3:120556883-120556905 TAAATAAGTGTAGGTTAAGGGGG - Intergenic
961961662 3:130861932-130861954 TAAATCATCATTGTGTTAGGAGG - Intronic
962062860 3:131949211-131949233 TAACTAAGTATTTGGTAAGTGGG - Intronic
964737919 3:159935124-159935146 TAAATTGGTATTGGGTAGTGGGG - Intergenic
973816447 4:54623699-54623721 TAAATAAGTAATGTGTCAGGGGG - Intergenic
975384001 4:73734050-73734072 AAAATCAGTAAAGGGTAAGTTGG - Intergenic
976747290 4:88416093-88416115 TAAATAATTATTGGGTAAAAAGG + Intronic
977225262 4:94386484-94386506 TAAAAGAGTATTGTGTAAGTTGG + Intergenic
977634846 4:99285705-99285727 CAAATAAGTATTTGGTAAAGTGG + Intronic
977637547 4:99317130-99317152 TAAATTGGTATTTGGTAAGGGGG + Intronic
978705356 4:111702590-111702612 TACATCAATTTTGGGAAAGGGGG - Intergenic
980078132 4:128315645-128315667 TAAATAAGTCTTGGGCAACGTGG - Intergenic
980855914 4:138439424-138439446 TATATCTGTAGTGAGTAAGGGGG + Intergenic
981592775 4:146382904-146382926 TATATCAGTATTGGGGGTGGGGG + Intronic
984503017 4:180580203-180580225 TAAATCAGTAATTCTTAAGGTGG - Intergenic
985018160 4:185659280-185659302 TGAATCAGTGCTGGGGAAGGAGG + Intronic
985018307 4:185660678-185660700 TGAATCAGTGCTGGGGAAGGAGG + Intronic
987534929 5:19172853-19172875 TAAATCAGTACTGGGGCAAGAGG - Intergenic
988162095 5:27531779-27531801 AAAATGAGTATTGGGAAATGAGG - Intergenic
993772184 5:91942632-91942654 TAATTCAGAATTGGGGGAGGGGG - Intergenic
995125081 5:108571481-108571503 TAAAAGAGTATTGTGTAAGTTGG + Intergenic
995296756 5:110532536-110532558 TAAAAGAGTATTGTGTAAGTTGG - Intronic
997222046 5:132177495-132177517 TAACTGAGGATTGGGAAAGGAGG + Intergenic
999587365 5:153105278-153105300 TAAATAAGTATTGGGAAAACTGG + Intergenic
1000773842 5:165391909-165391931 TAAATCAGTAATGAGTAACAAGG + Intergenic
1001821477 5:174713681-174713703 TTCATCAGTATTGGGTAACTGGG + Intergenic
1004963323 6:20818015-20818037 TAAATGAGTACTTGGTAAAGAGG - Intronic
1005234424 6:23743392-23743414 TTAATAAGTATTGGTTCAGGGGG - Intergenic
1006174197 6:32112061-32112083 TAAGTCAGTAGTGGTGAAGGTGG + Intronic
1007707647 6:43800598-43800620 TAAAAGAGTATAGGGTAAGAGGG - Intergenic
1008475252 6:51929244-51929266 TAAATCAGTCTTGGGGAAACAGG + Intronic
1010866823 6:80985592-80985614 TAAACCAATGTAGGGTAAGGAGG + Intergenic
1011325076 6:86141699-86141721 TAAATCAGCATTTGATAAAGAGG + Intergenic
1011807734 6:91091742-91091764 TAAATCAGTTTTTAGTAAGGTGG + Intergenic
1012037040 6:94155430-94155452 TGTATCAATATTGGGTCAGGGGG + Intergenic
1012646952 6:101696917-101696939 CACACCAGTTTTGGGTAAGGTGG + Intronic
1013009794 6:106109384-106109406 TGTATCAGTATTTAGTAAGGAGG - Exonic
1013051575 6:106540833-106540855 TAAATCAGCAATGGGAAAGTTGG - Intronic
1013127566 6:107199593-107199615 TAAAACAGTATTGTGTAGGTAGG - Intronic
1014309901 6:119787016-119787038 TAAAGCAGGATTCTGTAAGGAGG + Intergenic
1020666707 7:11053262-11053284 TAAATCAGTTTTGTGTTATGGGG + Intronic
1026728592 7:72891989-72892011 TAAATGAGCATTGGGGAAAGAGG - Intronic
1027977496 7:85178226-85178248 TAAATCAGTACTGGATAGTGTGG + Intronic
1029862572 7:103589375-103589397 AAAATAAGTATTGTGTAAAGTGG + Intronic
1029935013 7:104415376-104415398 AAAATCAGTATTGGGGAAAGGGG - Intronic
1030995150 7:116351233-116351255 TAAACCAGTTATGGGTATGGAGG + Intronic
1031079926 7:117248460-117248482 TTAATAAGTATTTTGTAAGGAGG + Intergenic
1035414138 7:158668387-158668409 GAAAACAGTAATAGGTAAGGAGG - Intronic
1035543492 8:460014-460036 TAAGTCAGCATTGGGCATGGGGG + Intronic
1036382119 8:8242979-8243001 TAAAACAGTCTTGGCTGAGGAGG - Intergenic
1036639564 8:10573963-10573985 TAAAAGAGTATTGTCTAAGGTGG - Intergenic
1036836445 8:12072873-12072895 TAAATTTGTTTTGGGTAAGTTGG - Intergenic
1036858286 8:12319442-12319464 TAAATTTGTTTTGGGTAAGTTGG - Intergenic
1038556849 8:28526123-28526145 TATATTAGTATTGGGTAACATGG + Intronic
1040365161 8:46708146-46708168 TGATTCATTATTGGGTAAAGTGG + Intergenic
1041993742 8:64027668-64027690 TTTAACAGTATTGGGTAAGAGGG + Intergenic
1044218224 8:89638268-89638290 AAAATCAGAATTAGGTAAAGTGG + Intergenic
1045515027 8:102851830-102851852 TAAAACAGTGTTGGGCAATGTGG + Intronic
1046010438 8:108539798-108539820 TAAATCTGTATTGTTTTAGGAGG + Intergenic
1046193582 8:110831493-110831515 TAAAGAAGTATCTGGTAAGGTGG + Intergenic
1046297338 8:112237824-112237846 AAACTCAGTATTCTGTAAGGGGG - Intronic
1052681526 9:31699267-31699289 TGAATCAGTTTTTGGTAAGTTGG - Intergenic
1053353989 9:37431212-37431234 TACATCAGTTTAGGGGAAGGGGG + Intronic
1055316632 9:75040465-75040487 TAAAACAGTATGGATTAAGGAGG + Intergenic
1058736822 9:107901203-107901225 CAAAGCAGAATTGTGTAAGGTGG + Intergenic
1059514108 9:114876871-114876893 TAAATTGGTACTGGGTAATGGGG - Intergenic
1060471926 9:123955260-123955282 TAAATCAGAATTGGGGCTGGGGG + Intergenic
1185831665 X:3309207-3309229 TAAATCCTTATTGGGCAAGCTGG + Exonic
1188781705 X:34294178-34294200 TAAATTAGTACTGGGTAGTGGGG + Intergenic
1189755581 X:44268231-44268253 AAAATCATTCTTGTGTAAGGAGG - Intronic
1191090433 X:56615522-56615544 TAAATGAGTATAGGGTCAGCCGG + Intergenic
1192040020 X:67609904-67609926 TAAATCATTTTTCAGTAAGGGGG + Intronic
1193748183 X:85309560-85309582 TAGATCAGTGTTGGGCAAGCTGG + Intronic
1195636884 X:107127403-107127425 TAAATGGCTATTGGTTAAGGTGG + Intronic
1195836580 X:109121734-109121756 TAAATAAGTATTTTGTAAGTTGG - Intergenic
1196268757 X:113685752-113685774 CAAATCAGTGTTGGGAAATGTGG + Intergenic
1196496945 X:116333519-116333541 TAAAACAGTATTGTCTAAGTTGG - Intergenic
1197396174 X:125930254-125930276 TAAATGCCTATTGGGTAAAGGGG + Intergenic
1197789583 X:130240390-130240412 TATAAAAGTATTGTGTAAGGAGG - Intronic
1201244334 Y:11987872-11987894 TAAATCCTTATTGGGCAAGCTGG - Intergenic