ID: 929317498

View in Genome Browser
Species Human (GRCh38)
Location 2:40497493-40497515
Sequence TAAATCAGTATTGGGTAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929317484_929317498 26 Left 929317484 2:40497444-40497466 CCATTACAGAGATATCCACAGGG 0: 1
1: 0
2: 1
3: 10
4: 141
Right 929317498 2:40497493-40497515 TAAATCAGTATTGGGTAAGGGGG 0: 1
1: 0
2: 1
3: 10
4: 159
929317490_929317498 11 Left 929317490 2:40497459-40497481 CCACAGGGGGCAGTGGGAGCAGA 0: 1
1: 0
2: 2
3: 52
4: 417
Right 929317498 2:40497493-40497515 TAAATCAGTATTGGGTAAGGGGG 0: 1
1: 0
2: 1
3: 10
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929317498 Original CRISPR TAAATCAGTATTGGGTAAGG GGG Intronic