ID: 929318776

View in Genome Browser
Species Human (GRCh38)
Location 2:40514360-40514382
Sequence GTGGGCAAACAGAAGGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 307}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929318768_929318776 29 Left 929318768 2:40514308-40514330 CCAGAGAGTAAACTTGAAGCCTG 0: 1
1: 0
2: 1
3: 16
4: 133
Right 929318776 2:40514360-40514382 GTGGGCAAACAGAAGGACAAAGG 0: 1
1: 0
2: 4
3: 20
4: 307
929318769_929318776 10 Left 929318769 2:40514327-40514349 CCTGAAATTGCAGCACTCATTTG 0: 1
1: 0
2: 0
3: 15
4: 194
Right 929318776 2:40514360-40514382 GTGGGCAAACAGAAGGACAAAGG 0: 1
1: 0
2: 4
3: 20
4: 307
929318767_929318776 30 Left 929318767 2:40514307-40514329 CCCAGAGAGTAAACTTGAAGCCT 0: 1
1: 0
2: 1
3: 12
4: 141
Right 929318776 2:40514360-40514382 GTGGGCAAACAGAAGGACAAAGG 0: 1
1: 0
2: 4
3: 20
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929318776 Original CRISPR GTGGGCAAACAGAAGGACAA AGG Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900560877 1:3305498-3305520 GTGGGCAAACAGATGGGAAATGG - Intronic
903042008 1:20537842-20537864 GTGGGTACACAGGAGAACAAGGG - Intergenic
903912996 1:26742226-26742248 CTGGGAAAACAGAAGTAAAATGG - Intronic
904083266 1:27885476-27885498 GAGGGGAGACACAAGGACAAGGG - Intronic
904978933 1:34480146-34480168 GAGGGGGAACAAAAGGACAAGGG + Intergenic
905628203 1:39502605-39502627 GGGGGCAGTCAGAAGGACACAGG + Intronic
906929634 1:50156439-50156461 CTGGGCCAACAGATGGATAAAGG + Intronic
908342047 1:63191635-63191657 CTGTCCAAACAGATGGACAAGGG - Intergenic
909127701 1:71695519-71695541 GAGGGAAAACAGTAGGAAAAAGG - Intronic
909483634 1:76151259-76151281 GTGGGCAAACAGGGGGGCAAGGG + Intronic
910298853 1:85682889-85682911 GTGGGCAAACAGAAGTTGAAGGG + Intronic
910763966 1:90762135-90762157 GTGGCCAAACAGCAGAACAATGG + Intergenic
914260752 1:145997150-145997172 GCGGGGCAAGAGAAGGACAAAGG - Intergenic
914422243 1:147540118-147540140 GTGAGCAAAAAGGAGCACAAAGG - Intergenic
915431817 1:155872592-155872614 GCAGGCAAGCAGAAGGACAAGGG - Intronic
915928448 1:160042083-160042105 CTGGGCAATAAGAAGCACAATGG + Exonic
916180125 1:162076213-162076235 GAGGGTAGACAGCAGGACAAGGG - Intronic
917218380 1:172701705-172701727 GTGGGAACACAGAGGGAAAATGG + Intergenic
918245308 1:182654228-182654250 GTGTGCAGACAGAAGGGAAAGGG + Intronic
919977162 1:202620180-202620202 CTGGGCAGACAGAAGGACAGCGG - Intronic
920350127 1:205332383-205332405 GAGGGCACACAGAAGGACCCAGG - Intergenic
920824651 1:209413993-209414015 CTGAGCAAAGAGAAGGAAAACGG + Intergenic
921283813 1:213591411-213591433 GGTGGGAAACAGAAGGAGAATGG - Intergenic
923143323 1:231179911-231179933 CTGGGCAAAGAGTAGGAGAAGGG + Intronic
923144886 1:231190849-231190871 GTGGGGAAAGAATAGGACAAAGG - Intronic
924297420 1:242602156-242602178 GTCGGCAAAAAGAAGGGCAGCGG + Intergenic
924680008 1:246221452-246221474 GTGGGCAAAGAGAAGGAGAAAGG + Intronic
1064322390 10:14317796-14317818 TTGGGAAAAAAGAAGGCCAAAGG + Intronic
1065971472 10:30809434-30809456 GTGGGGACCAAGAAGGACAAGGG - Intergenic
1067547792 10:47207335-47207357 GTGGGAAGACAGAAGCCCAAAGG - Intergenic
1067687827 10:48478425-48478447 GTGGGCAAACAGAGGAGCAAAGG + Intronic
1067935446 10:50608339-50608361 GAGGGGAAAGAGAAGGAAAAGGG + Intronic
1069166756 10:65169638-65169660 GTGGCCAAAAACAAGGACCAGGG - Intergenic
1070170393 10:73928476-73928498 GGGAGCAGACAGAAGGGCAATGG + Intergenic
1070714281 10:78707927-78707949 GTGTGCATACAGAAGGAGGAAGG - Intergenic
1072896076 10:99367938-99367960 GTGGGGAAAGAGAAGGACAATGG + Intronic
1073107119 10:101038618-101038640 GTGGAGAGACAGAAAGACAATGG - Intronic
1074101586 10:110358344-110358366 GTGGGGGAACAGAGGGACAGAGG - Intergenic
1074700517 10:116088090-116088112 ATGGAGAACCAGAAGGACAAAGG + Intronic
1075451153 10:122552800-122552822 GCGGGCAAACAGAGGGTCATGGG - Intergenic
1076432014 10:130410687-130410709 GTGGGCTAACGGAATCACAAGGG - Intergenic
1077471480 11:2762899-2762921 GTGGGCAGACAGATGAACAGTGG - Intronic
1078084415 11:8225100-8225122 GTGGGGAGACAGATGGAGAAAGG + Intronic
1078714740 11:13829104-13829126 GTGGGGAGACAGAGGGAGAAGGG - Intergenic
1079940602 11:26675540-26675562 GTGAGAAAAGAGAAGGTCAAAGG + Intronic
1080797240 11:35576099-35576121 GTGGACAAACAGAGAGACACCGG - Intergenic
1082085966 11:48049794-48049816 GTGGGCAGACAGATTGACAGTGG + Intronic
1082798045 11:57392666-57392688 GAGGTCAAACAAAAGGAGAAGGG + Intronic
1085140662 11:74138232-74138254 GTGGCCAAATAGAAGAAGAAAGG - Intronic
1085331302 11:75653822-75653844 GTGTGCAATGAGAAGGGCAAAGG + Intronic
1085587228 11:77720962-77720984 GTGGGCAAAAAAATGGAAAATGG - Intronic
1086656023 11:89356425-89356447 GGGGGAAAAAAAAAGGACAAAGG + Intronic
1086685140 11:89725006-89725028 ATAGGCAAACAGAATGACAAAGG - Intergenic
1087711811 11:101562669-101562691 GGGGTCAGAAAGAAGGACAAAGG - Intronic
1088747925 11:112820095-112820117 GTGGGAAGTAAGAAGGACAAAGG - Intergenic
1089330239 11:117684273-117684295 GTGGGGAGAAAGAAGGAGAAGGG - Intronic
1089625687 11:119749288-119749310 GTGGGCAAACTGAAGGGGGAGGG + Intergenic
1089945097 11:122462218-122462240 TTGGGCAAACACAAGGATCATGG - Intergenic
1090168442 11:124576700-124576722 ATGGGCAAACATATAGACAAAGG - Intergenic
1090417955 11:126553749-126553771 GTGGCCAGGCAGAAGGGCAATGG - Intronic
1090427661 11:126620079-126620101 GTGGGCAAACAGCAAAACAGTGG - Intronic
1091008997 11:131981332-131981354 GTGGTCAAACAGAGGCACATTGG - Intronic
1091086113 11:132723654-132723676 GTGGGCAATGAGAAAGAGAAAGG - Intronic
1091204782 11:133812729-133812751 GTGTAAAAACAGAAGGAAAATGG + Intergenic
1091572461 12:1699947-1699969 GTGTCCAGACAGAAGGAAAAGGG + Intronic
1091844824 12:3647800-3647822 GTGAGGAAACAGAAGGACTTTGG - Intronic
1092025492 12:5236051-5236073 GTTGGAAAACAGAGAGACAAGGG - Intergenic
1092290356 12:7156621-7156643 GTGGGCACACAGCTGCACAAAGG - Intronic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1093341359 12:17978590-17978612 GTGGGAAGATAGAAGTACAAAGG - Intergenic
1093868379 12:24256481-24256503 TTGGGCAACTAGAAGGAGAAGGG - Intergenic
1093903802 12:24665564-24665586 CTGGGGAAACAGAAGCAGAAAGG + Intergenic
1093993273 12:25613959-25613981 GAGAGGAGACAGAAGGACAAAGG + Intronic
1094018705 12:25891478-25891500 GTGAGCACACAGGTGGACAAAGG - Intergenic
1095095678 12:38147194-38147216 GTGGGAGAACAGATGGACAGAGG - Intergenic
1095523817 12:43101072-43101094 GTGGGCAGAAAGAAGTGCAAAGG + Intergenic
1096275762 12:50206696-50206718 GTAAGGCAACAGAAGGACAAAGG - Intronic
1097283514 12:57860483-57860505 GTGGGCAGCCAGGAGGAGAAAGG + Intergenic
1097803582 12:63941261-63941283 TTATTCAAACAGAAGGACAAGGG - Intronic
1098070442 12:66668729-66668751 CTGGGCAAACATAGGGACATAGG + Intronic
1099319925 12:81133357-81133379 GTGGGCAATTGGAAGGACCATGG - Intronic
1102784448 12:115592826-115592848 GTGGGCAAACAGCTGGAGGATGG - Intergenic
1103277243 12:119722793-119722815 GAGGGAAGAAAGAAGGACAAAGG - Intronic
1104239198 12:126971098-126971120 GTGTGAAAACAGAGGGGCAATGG + Intergenic
1104402860 12:128491115-128491137 GTGGCCAAACAGAAGGTGACAGG + Intronic
1106438918 13:29748282-29748304 TGGGGCAAGCAGAAGGGCAAAGG - Intergenic
1107171204 13:37343781-37343803 GTGGGCACTGAGAAGGAGAAAGG + Intergenic
1107854417 13:44600826-44600848 GTGGGCAACTAGAAAGATAATGG - Intergenic
1108830823 13:54476139-54476161 CTGGGCAAGCAGAAAGAAAAAGG - Intergenic
1113350809 13:109527379-109527401 GAGGGAAAAAAGAAGGAAAAGGG - Intergenic
1113526825 13:110985535-110985557 GTTGGCCACCAGAAAGACAAAGG - Intergenic
1114547517 14:23513501-23513523 GTGTACAACCAGAAGGACAGAGG + Intergenic
1114600644 14:23953473-23953495 GTGGGCAAGCAGATGCAGAAAGG + Intergenic
1114610328 14:24036164-24036186 GTGGGCAAGCAGATGCAGAAAGG + Intergenic
1115124106 14:29972178-29972200 GAGGGCAAACAGAAGCAAAGTGG + Intronic
1115297341 14:31843716-31843738 CTGGGCAAAAACAAGGAAAAGGG - Intronic
1116682513 14:47991564-47991586 GGGGGGAAATAGAAGGAAAAGGG - Intergenic
1118235718 14:64003619-64003641 GTAAACACACAGAAGGACAAGGG - Intronic
1119149958 14:72349666-72349688 GTGGGCAAACATAAGGAAAAAGG + Intronic
1119914864 14:78388718-78388740 CTTGGAAAACAGAAGTACAAAGG + Intronic
1119931225 14:78549345-78549367 GTGAACAAAGAGAAGGAGAAGGG - Intronic
1120178090 14:81316626-81316648 GTGAGGAAACTGAAGTACAAAGG - Intronic
1121329791 14:93042676-93042698 GTGGGCAAAGAAAGGGAGAAGGG + Intronic
1121858046 14:97288592-97288614 GTGGGCAGCCTGAAGCACAAAGG - Intergenic
1122895651 14:104755517-104755539 GAGGGCACACAGGAGGACGATGG + Intronic
1124492825 15:30168564-30168586 CTGGGCAGACAGAAGGACAGTGG - Intergenic
1124750709 15:32369761-32369783 CTGGGCAGACAGAAGGACAGTGG + Intergenic
1124841375 15:33245016-33245038 GTGGGGAAAAAGAAAGTCAAGGG + Intergenic
1125374111 15:39010914-39010936 GTAGGAAAATAAAAGGACAAAGG - Intergenic
1125680844 15:41529375-41529397 CAGGGCACACAGAAGGTCAAAGG + Intronic
1128668294 15:69554622-69554644 CTGGGCAAATAAAAGAACAAAGG - Intergenic
1132097237 15:98996727-98996749 CTGGGCAAGCAGAAGGTAAAGGG - Intronic
1132847448 16:2007036-2007058 ATGGGCACACAAAAGGACAGCGG + Intronic
1132989754 16:2786679-2786701 GAGGACAGACAGAAGGACCACGG - Exonic
1133166426 16:3950767-3950789 GTGAGCAGACAGAAAGAAAATGG + Intergenic
1133387640 16:5383195-5383217 GTGGGGAAACAGGAGGAGTAGGG + Intergenic
1134684813 16:16150990-16151012 GTGGGGAAACTGAGGCACAAAGG - Intronic
1136105928 16:28030484-28030506 GGAGACAGACAGAAGGACAATGG + Intronic
1136492780 16:30621310-30621332 CTGGGCAAACAGATAGAAAAGGG - Intronic
1137030518 16:35519579-35519601 CTGGGCAAACAGATAGAAAAGGG + Intergenic
1138243486 16:55447720-55447742 ATGGCCAAGCAGAAGGACCAAGG + Intronic
1140073786 16:71677258-71677280 GTGGGCACTAAGTAGGACAAAGG + Intronic
1140389876 16:74576613-74576635 GTGGGCAAACTGTAGTCCAAGGG - Intronic
1140820709 16:78660362-78660384 TTGGGGAAACAGAAGGAAATTGG + Intronic
1141383355 16:83596251-83596273 ATGGGCAGAGAGAAGCACAAGGG + Intronic
1142141641 16:88475295-88475317 GTGGGCACACACAGGGACCATGG + Intronic
1142616540 17:1139720-1139742 GTGGGAAACCAGATGGACACAGG + Intronic
1145302100 17:21648017-21648039 GTGGGCCCACAGAAGGGGAAGGG - Intergenic
1145328446 17:21850801-21850823 GTGGGCCCACAGAAGGGGAAAGG - Intergenic
1145348210 17:22055299-22055321 GTGGGCCCACAGAAGGGGAAGGG + Intergenic
1145415370 17:22710085-22710107 GTGGGCCCACAGAAGGGGAATGG - Intergenic
1145960326 17:28883384-28883406 GTGGGGAGACAGCAGCACAAGGG + Intronic
1147210288 17:38869433-38869455 GTGGTGTAACAGAAGGAGAAAGG + Intergenic
1147260798 17:39208918-39208940 GTGGGCACAGAGGAGGGCAAAGG + Intergenic
1147549185 17:41426675-41426697 GAGGGAAACCAGAAGGACCATGG + Intergenic
1147572084 17:41577571-41577593 GTGAGCCAGGAGAAGGACAAAGG + Intergenic
1148594615 17:48843592-48843614 GTGGCCAACCAGCAGGACACTGG + Intronic
1149126078 17:53235048-53235070 GTGGGGAACCTGAAGCACAAAGG - Intergenic
1149569401 17:57661799-57661821 GAGGGCAAAGACAAGGACAGAGG - Intronic
1152975956 18:218492-218514 AAGGGCAAACAGAAGAACCATGG + Intronic
1155313878 18:24551997-24552019 GTGAGCCAGCAGAAGGAGAATGG - Intergenic
1156571503 18:38258927-38258949 GTGGGTAAAAAGGAGAACAAAGG - Intergenic
1157495170 18:48151917-48151939 GTGGGGAAGCAGTGGGACAAAGG + Intronic
1157518056 18:48324966-48324988 GTTAGCAGACAGGAGGACAATGG + Intronic
1160278342 18:77461373-77461395 GGAGGCAAAGACAAGGACAATGG - Intergenic
1160871814 19:1281244-1281266 GTGGGCACACCGAGGGGCAAGGG - Intergenic
1162267501 19:9587893-9587915 GTGGGCACACACCTGGACAAGGG + Intergenic
1162278054 19:9674034-9674056 GTGAGCACACACCAGGACAAGGG + Intronic
1162531468 19:11238549-11238571 GTGGGAATACAGAAGGACATTGG + Intronic
1162622924 19:11858839-11858861 GTGGGCAAACAGATAGAAAAGGG - Intronic
1163832281 19:19552783-19552805 GTGGGGAAACAGAAGCTCAGGGG + Intergenic
1165673591 19:37701583-37701605 GTGGGCACACATTTGGACAAGGG - Intronic
1166075775 19:40413109-40413131 ATGGGGAAACAGAGGCACAAAGG + Intronic
1166257082 19:41614536-41614558 GTGGGCAAAGAATAGGACACAGG - Intronic
1168077022 19:53986349-53986371 GGTGGCAAATAGACGGACAAGGG + Exonic
1168576249 19:57513523-57513545 CTGGGCAAACAGATAGAAAAGGG + Intronic
929073686 2:38059717-38059739 GTGGGCAAAGAAAATGAGAAAGG + Intronic
929318776 2:40514360-40514382 GTGGGCAAACAGAAGGACAAAGG + Intronic
929759774 2:44797504-44797526 ATGAGGAAACAGAAAGACAAAGG + Intergenic
930196123 2:48512205-48512227 CTGGGCAAGCAGAAGGATTATGG - Intronic
931078025 2:58738253-58738275 GTGTACATACAGAATGACAAAGG - Intergenic
931437177 2:62257742-62257764 CTGTGGAAACAGAAGAACAAAGG + Intergenic
935985207 2:108665966-108665988 GTGTGCAAGCAGAGGGAAAATGG - Intronic
936137642 2:109909610-109909632 GTGTGCAAGCAGAGGGAAAATGG - Intergenic
936207055 2:110461875-110461897 GTGTGCAAGCAGAGGGAAAATGG + Intronic
938374856 2:130798458-130798480 CTGGGTACACAGCAGGACAATGG + Intergenic
942993220 2:182228269-182228291 ATTAACAAACAGAAGGACAATGG + Intronic
946273030 2:218609949-218609971 GTGAGCAAACAGGAAGACAGAGG + Intronic
946299746 2:218815296-218815318 GTAGTCAAAAAGAATGACAAAGG - Intergenic
946334944 2:219030213-219030235 GTGGCCAAGCAGAAGGACAAAGG + Intronic
946876842 2:224138004-224138026 GAGGGCAAAGAGAAGGAAGAGGG - Intergenic
947223879 2:227821671-227821693 GTGGTCAAAGAGCAGGAGAATGG + Intergenic
947931727 2:233970311-233970333 GTAGGCAAACAGCAGGAGGAAGG - Exonic
948410345 2:237755009-237755031 GTGGGCGAACAGAAGTGCCAGGG + Intronic
948834084 2:240616185-240616207 AGAGGCAAACAGAAGGAAAAAGG - Intronic
1169736556 20:8844213-8844235 AACGGCAAACAAAAGGACAACGG - Intronic
1171284681 20:23927215-23927237 ATGGGCAAAATGAAGGTCAATGG - Intergenic
1171518687 20:25759445-25759467 GTGGGCCCACAGAAGGGTAAGGG - Intergenic
1171558166 20:26096764-26096786 GTGGGCCCACAGAAGGGGAAGGG + Intergenic
1173493859 20:43504907-43504929 ATGGGGAAACAGAAGGGGAATGG - Intergenic
1173572881 20:44088884-44088906 ATGGGGAAACTGAAGGACAGGGG - Intergenic
1173602571 20:44306592-44306614 GAGGGGGGACAGAAGGACAATGG - Exonic
1174188204 20:48721918-48721940 CTGAGCAACCAGAAGGACAGAGG + Intronic
1174653525 20:52150383-52150405 GTGGGAAAAGAGAAAGACATAGG + Intronic
1174859288 20:54075281-54075303 GGTGGCATACAGAAAGACAAAGG - Intergenic
1175366306 20:58458632-58458654 GTGGACTGACAGAAGGACCAGGG + Intergenic
1176652833 21:9565850-9565872 GTGGGCCCACAGAAGGGGAAGGG - Intergenic
1177095525 21:16827134-16827156 TTGGGCAAAAAGAAAGCCAAAGG + Intergenic
1177724979 21:24955614-24955636 GAGGGGAAACAGTAGGATAAGGG - Intergenic
1179623633 21:42634600-42634622 GTGGGTGAGCAGATGGACAATGG - Intergenic
1179623705 21:42635164-42635186 GTGGATGAACAGATGGACAATGG - Intergenic
1180050971 21:45330851-45330873 TTGGGCGAAAAGAAGGAAAAGGG - Intergenic
1182332276 22:29559678-29559700 GTGGGGCAAGAGAAGGAGAAGGG - Intronic
1182374080 22:29833457-29833479 GTGGAAAAAGAGAAGGACCAGGG + Intronic
1183291366 22:37003790-37003812 GTTGGAAGACAGAAGGAAAAAGG - Intronic
1185241179 22:49748633-49748655 CTGGGGAAACAGGAAGACAAGGG - Intergenic
949130330 3:492394-492416 AGGGGCAAACTGAAGGAAAATGG + Intergenic
951183227 3:19682776-19682798 GAGGGCAAGCCGAAGCACAATGG - Intergenic
951547113 3:23837902-23837924 GTGGACAAGCAGAAAGAAAAGGG - Intronic
951652443 3:24965609-24965631 GTGGCAAAACAGAAGGACAGAGG - Intergenic
954989637 3:54829623-54829645 GTGTGCAAACTGCAGGACATGGG + Intronic
956707397 3:72011185-72011207 GTGGGCAGGCAGAAGAACCAGGG + Intergenic
957840717 3:85665659-85665681 GTGGACTACCAGAAAGACAAAGG - Intronic
960169968 3:114448452-114448474 GAGGGCAAACAGATGGATCAAGG + Intronic
960467332 3:118013526-118013548 GTGCACTAACAGAAGGAGAAGGG + Intergenic
960880025 3:122334766-122334788 GTTGGAAAACAGATGAACAATGG + Intronic
962351657 3:134660832-134660854 GAGGCCATACAGAAGGAAAATGG - Intronic
965307224 3:167081414-167081436 GTGGGAAAAGAGAAGGAACAGGG + Intergenic
965420332 3:168449945-168449967 GTGGGGAAACAAAGGGAGAATGG - Intergenic
966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG + Exonic
967495620 3:190142054-190142076 GTGGACAACTAGAAGGAGAAGGG - Intergenic
970422087 4:15914843-15914865 GTGGGCAAGCACCAGGAGAAGGG + Intergenic
973276649 4:48317417-48317439 GTGGACAAACAAAATGATAAAGG - Intergenic
973865149 4:55105451-55105473 GGAGGCAATCAGAAGGACATAGG - Intronic
976059166 4:81106467-81106489 GTGGGCTATCAGAAGGACCTGGG + Intronic
977086435 4:92604753-92604775 GTGGGTAAGCTGAAGGACAGTGG - Intronic
977385584 4:96335260-96335282 GTTGGCAAAGAGATGGAGAAAGG - Intergenic
977912833 4:102557739-102557761 GTGGGAAAAGAGAAGTACAAGGG + Intronic
980574308 4:134665848-134665870 GTGGGCAACAAGAAGGAGAAAGG - Intergenic
981427934 4:144625345-144625367 GTGGGCAAAAAGAATGATCAAGG + Intergenic
981639604 4:146925542-146925564 ATGGCCACACAGAAGTACAAAGG - Intronic
982597193 4:157401539-157401561 GAGGGAAAACAGAAGGCAAATGG + Intergenic
986303222 5:6495056-6495078 CTGGGCAAAGGGAAGGAGAAGGG + Intergenic
986775681 5:11011891-11011913 GTGGGAAAGCAGAAAGACAGTGG + Intronic
989196166 5:38718691-38718713 GTGTGCAAATATGAGGACAAGGG + Intergenic
991647345 5:68814651-68814673 GTAGGCAAAAACAAGGACACTGG - Intergenic
992733146 5:79691900-79691922 GTGGGAAAACTGAAGGGCATGGG + Intronic
995756130 5:115506313-115506335 GTGGGCAAGAAGAAGGAGACTGG - Intergenic
996457111 5:123697189-123697211 ATGGGCAAAGAGAAAGAGAATGG + Intergenic
999275683 5:150328552-150328574 GTGGGCCAGCAGAAAGACCATGG + Intronic
1000367983 5:160508614-160508636 GTGGCAAAAGAGAAGGACATTGG - Intergenic
1001334907 5:170789044-170789066 GTGGGCAAACACAAGCTCAAGGG + Intronic
1003911146 6:10744957-10744979 GTCGGCAGACAGGAGAACAAAGG - Intergenic
1004148060 6:13088686-13088708 GTGAGCAAAAATAAGGAGAAAGG - Intronic
1004991022 6:21138898-21138920 AAGGGCACACAGAAGGAGAAAGG - Intronic
1005076636 6:21914552-21914574 GTGAGCAAAGATAAGGCCAAAGG - Intergenic
1007759588 6:44126140-44126162 GAGGGCAAATAGAAGGGCACAGG + Intronic
1007995194 6:46300131-46300153 GTGGGAAAAAAGAGGGAAAAAGG + Intronic
1008995623 6:57655221-57655243 GTGGGAATGTAGAAGGACAAAGG + Intergenic
1009030774 6:58055784-58055806 GTGGACAGAAAGAAGGAGAAGGG + Intergenic
1009206630 6:60810245-60810267 GTGGACAGAAAGAAGGAGAAGGG + Intergenic
1009299624 6:61998675-61998697 TTTGGAAAGCAGAAGGACAAAGG - Intronic
1009714916 6:67378945-67378967 AAGGGGAAACAGAAGGAAAAGGG - Intergenic
1010179410 6:73067707-73067729 GTGGGAAAACAGAAGAGAAATGG - Intronic
1010846621 6:80717042-80717064 GTGGGTAGTCAGAAGGACAGAGG - Intergenic
1011146938 6:84227943-84227965 GTGCGGAAACACAAGGACCAGGG - Intergenic
1011570619 6:88730439-88730461 GTGAGCACACAGTTGGACAAGGG - Intronic
1014096192 6:117464787-117464809 GTGAACATACAGAAGAACAAGGG + Intronic
1014762880 6:125377309-125377331 GTGGGAAAACACAAAGACGAAGG + Intergenic
1014944765 6:127484092-127484114 GAGGTCAAAGAGAAGGACAGGGG + Intronic
1017552428 6:155523255-155523277 GTGGGAAAAATGAAGGACAAAGG - Intergenic
1017788601 6:157776042-157776064 GTGGATGAACAGAAGGAAAATGG + Intronic
1018217000 6:161538257-161538279 ATGGGCAAACAGACAGGCAAGGG + Intronic
1021408145 7:20297994-20298016 TGGAGCAAACAGTAGGACAATGG - Intergenic
1021942314 7:25689802-25689824 GTGGGCAAACAGCTGGAGGATGG - Intergenic
1022273710 7:28835638-28835660 GAGGACCCACAGAAGGACAAAGG + Intergenic
1022688249 7:32617047-32617069 GTGGGCAAATAGAATGAATATGG - Intergenic
1023737625 7:43248766-43248788 GAGGGGAAACAGGAGGAGAACGG - Intronic
1023911342 7:44559078-44559100 GTGGGGCAACAGTAGGAGAAGGG - Intergenic
1024944809 7:54797939-54797961 GTGGGCCACCAATAGGACAAAGG + Intergenic
1025279179 7:57614562-57614584 GTGGGCCCACAGAAGGGGAAGGG - Intergenic
1025305552 7:57850938-57850960 GTGGGCCCACAGAAGGGGAAGGG + Intergenic
1026771569 7:73204251-73204273 GGGAGTAAACAGAAGGATAAGGG + Intergenic
1026986839 7:74560085-74560107 GTGGCTAAACAGAAGGGCAGAGG - Intronic
1027012435 7:74757647-74757669 GGGAGTAAACAGAAGGATAAGGG + Intronic
1027075605 7:75188406-75188428 GGGAGTAAACAGAAGGATAAGGG - Intergenic
1027163259 7:75817394-75817416 GTGGGCGAGCAGAAGGTCATTGG + Intronic
1029724507 7:102393402-102393424 GTGGGACAAAAGAAGGAAAAAGG - Intronic
1030663587 7:112249568-112249590 GTGGTCAAAGAGAAGGAAATAGG + Intronic
1032982960 7:137306171-137306193 GAGGGCAACTGGAAGGACAAAGG - Intronic
1034942194 7:155237741-155237763 GTGGCCCATCAAAAGGACAAAGG + Intergenic
1035141462 7:156766698-156766720 GTGGGCAAGCAGGAGGAGCAGGG + Intronic
1035421219 7:158730205-158730227 ATGGACAGACAGATGGACAAAGG + Intergenic
1036114045 8:5939032-5939054 GTGAGTAAACAGAAAAACAAAGG + Intergenic
1038865915 8:31438782-31438804 GTGGTCAGATAGATGGACAATGG + Intergenic
1038906341 8:31908013-31908035 GTGGGACAAAAGAAGGAAAATGG - Intronic
1039351254 8:36766365-36766387 GTGGGGAACCAGAATGAAAAAGG - Intergenic
1039906607 8:41791008-41791030 GTGGGCTGACAGCAGGACAGAGG + Intronic
1041289975 8:56299438-56299460 CTGAGGAAACAGAAGGACACAGG - Intergenic
1042612889 8:70617460-70617482 GTGGGCAAAATGATGGACAGAGG + Intronic
1042819225 8:72911929-72911951 AAGGGGAAACAGAAAGACAATGG - Intronic
1042881687 8:73499548-73499570 TTTGGCAATCAGTAGGACAAGGG + Intronic
1044295734 8:90525154-90525176 ATGGGAAAATAGAAGAACAAGGG - Intergenic
1047052666 8:121130208-121130230 GTGGACACACAGGAGGACCAAGG - Intergenic
1047335892 8:123935885-123935907 GGGGACCAACAGAAGGAAAATGG + Intronic
1048173090 8:132127176-132127198 GCTGGCAATCTGAAGGACAAAGG - Exonic
1048580167 8:135724052-135724074 GTGTGAAAGCAGAAGGACAATGG - Intergenic
1048973473 8:139657978-139658000 GTGGGCAGATATATGGACAATGG + Intronic
1049816626 8:144606039-144606061 GAGGGCGAACAGGAGGACACAGG + Intergenic
1050453657 9:5810375-5810397 TTGGCCAAACACAAGAACAAGGG + Intronic
1050699288 9:8319434-8319456 GTAGGCATACAGAGGGAGAATGG + Intronic
1051570300 9:18549498-18549520 GTGGGCAAAAAGCAAAACAATGG + Intronic
1052044583 9:23779307-23779329 GTGGGCAGACAGAGGAACAAAGG + Intronic
1052313113 9:27090067-27090089 GAGAGCCAACAGAGGGACAAAGG + Intergenic
1052361477 9:27565281-27565303 CTGGGCAAACAGAAAAAAAAAGG + Intronic
1052901518 9:33798094-33798116 GGGGGGAAGTAGAAGGACAAAGG - Intronic
1053195165 9:36111874-36111896 GTTGGCAATAAAAAGGACAAAGG + Intronic
1053302233 9:36960442-36960464 GTGAGCAAGCAGAGGGACATGGG + Intronic
1055106983 9:72523225-72523247 GTGGGGAAAATGAAGGAGAAGGG + Intronic
1055498354 9:76878228-76878250 ATGGCCAAAGAGAAGGAAAAGGG + Intronic
1055699024 9:78920979-78921001 GAGAGAAATCAGAAGGACAAAGG - Intergenic
1056023633 9:82467580-82467602 GCTGGCAAACAGAAGGGTAATGG + Intergenic
1056304389 9:85274857-85274879 GTTGGCAGACAGAAAGAAAAGGG - Intergenic
1059933861 9:119288167-119288189 GGGAGAAAAAAGAAGGACAATGG - Intronic
1061346865 9:130033428-130033450 CTGTGCAAATAGAAGTACAAGGG + Intronic
1062246624 9:135571702-135571724 GTGGGCACACACCTGGACAAGGG + Intergenic
1203630562 Un_KI270750v1:69391-69413 GTGGGCCCACAGAAGGGGAAGGG - Intergenic
1186006928 X:5082454-5082476 GTCGGCACCCAGAAGGAAAAGGG - Intergenic
1187016913 X:15338290-15338312 GTGGGCAGACAGAAGAAGAGTGG + Intergenic
1187291206 X:17955139-17955161 GGGGGCAGACAGGGGGACAAAGG + Intergenic
1187668397 X:21641902-21641924 GTGGGAGAACAGAAGGGGAAAGG + Intronic
1188137990 X:26513118-26513140 ATGGGCAAACGGCAGGAAAAGGG - Intergenic
1190593814 X:52032940-52032962 TTGGGCAAAGAGAGGGAAAAGGG - Intergenic
1190778402 X:53573880-53573902 GAAGGCAAACAGAAAGGCAAGGG - Exonic
1193020651 X:76789010-76789032 GTGAGTAAACAGGAGGGCAACGG - Intergenic
1193138589 X:78001090-78001112 ATGGGCAAACAGAAATAGAAGGG - Intronic
1194309536 X:92287505-92287527 GTGGGAAGACAGAATGCCAACGG - Intronic
1194775784 X:97962532-97962554 GTTGACACACAGCAGGACAAAGG - Intergenic
1195377428 X:104241296-104241318 GTGGGAAAAAAGTAGGACTATGG + Intergenic
1195559639 X:106268963-106268985 GTGGTCAGACAGATGGGCAATGG + Intergenic
1195562322 X:106297376-106297398 GTGGTCAGACAGATGGGCAATGG - Intergenic
1197698658 X:129578757-129578779 GTGCACAAAAAGAAGGAAAAAGG - Intronic
1198697819 X:139362595-139362617 GTTGCCAAACATAAGGACAAGGG + Intergenic
1199423179 X:147670258-147670280 GAGGACCAACAGAAGGACATGGG + Intergenic
1200617829 Y:5401766-5401788 GTGGGAAGACAGAATGCCAACGG - Intronic
1202173820 Y:22079355-22079377 GTGGGCATAAAGAAGGAAGAAGG + Intronic
1202217540 Y:22507027-22507049 GTGGGCATAAAGAAGGAAGAAGG - Intronic
1202325645 Y:23689032-23689054 GTGGGCATAAAGAAGGAAGAAGG + Intergenic
1202350475 Y:23985030-23985052 GTGCAAAAACACAAGGACAATGG + Intergenic
1202520304 Y:25685091-25685113 GTGCAAAAACACAAGGACAATGG - Intergenic
1202545126 Y:25981022-25981044 GTGGGCATAAAGAAGGAAGAAGG - Intergenic