ID: 929319107

View in Genome Browser
Species Human (GRCh38)
Location 2:40519392-40519414
Sequence GAAGGCACAGAGTGTCAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1239
Summary {0: 1, 1: 0, 2: 2, 3: 93, 4: 1143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929319107 Original CRISPR GAAGGCACAGAGTGTCAGAT TGG (reversed) Intronic
900527781 1:3137518-3137540 GGAGGCACTGGGGGTCAGATTGG + Intronic
900626391 1:3610624-3610646 GAAGGAACTGAGTGCCAGAATGG - Intronic
900734604 1:4290019-4290041 AAAGGCACAGAGTGGCAAGTTGG - Intergenic
901136311 1:6999036-6999058 GTGGGCACAGAGTTTCAGTTTGG - Intronic
902107116 1:14047048-14047070 GAATGCACAGATGGACAGATGGG - Intergenic
902110259 1:14072477-14072499 GGAGGCACAGAGTGTTGGAGAGG - Intergenic
902112060 1:14089235-14089257 AAAGACATAGATTGTCAGATTGG - Intergenic
902226954 1:15002268-15002290 GAGGGCACAGAATGTCAAAGGGG + Intronic
902844460 1:19098982-19099004 GAAGGAACAGAGAGTAAGAAAGG + Intronic
903229307 1:21912214-21912236 GAAGACACAGAGGCTCAGAGAGG - Intronic
904256296 1:29257153-29257175 GAAAGAACAAAGTGTCAGATTGG + Intronic
904297452 1:29529873-29529895 AAAGGCAGAGATTGTCATATTGG + Intergenic
904361915 1:29981423-29981445 AAAGGCAGAGATTATCAGATTGG - Intergenic
904380211 1:30105521-30105543 GAAGACACAGAGGGTCAGGGAGG + Intergenic
904862938 1:33552987-33553009 GAAAGAAAAGATTGTCAGATAGG + Intronic
904958354 1:34308084-34308106 GAAGGCACAGTGTGGCAAGTTGG + Intergenic
905405255 1:37728207-37728229 GAAGGCGGAGAGTGGCAAATAGG + Intronic
905534338 1:38708317-38708339 AAAGGCAAAGAGTATCAGATGGG + Intergenic
905922607 1:41729392-41729414 GAAGGCACTGGTTCTCAGATTGG + Intronic
906451904 1:45957386-45957408 TAAGGCAGAGATTGTCAGACTGG - Intronic
906605592 1:47168090-47168112 AAAGACACAGACTGTCAAATTGG + Intergenic
908305808 1:62814741-62814763 AAAGGCAAAGATTATCAGATTGG - Intronic
908714687 1:67056451-67056473 GAAGGGACAGAAGGTCAGAAAGG + Intergenic
909051274 1:70771625-70771647 AAAGGCACAGAGTGACAAACTGG - Intergenic
909414444 1:75388852-75388874 AAAGGCATAGAGTGGCAAATTGG + Intronic
909697759 1:78486046-78486068 GAAGACACAGACTGGCAAATTGG + Intronic
909713203 1:78674941-78674963 GAAGTCACAGAGTGTGAGAAGGG - Intergenic
909733856 1:78931620-78931642 AAAGGCACAGACTGGCAAATTGG + Intronic
910797242 1:91109975-91109997 AAAGGCATAGAGTGGCTGATTGG + Intergenic
911013952 1:93312006-93312028 AAAGGCACAGAGTGGCTGAATGG + Intergenic
911284399 1:95972909-95972931 AAAGACACAGACTGGCAGATTGG - Intergenic
911673743 1:100636193-100636215 AAAGACACAGACTGGCAGATTGG - Intergenic
911823075 1:102444255-102444277 AAAGGCACAGACTGGCAAATTGG + Intergenic
912225982 1:107734398-107734420 AAAGACACAGACTGTCAAATAGG + Intronic
912501351 1:110124385-110124407 GATGGCACAGAGTAGCAGTTAGG + Intergenic
913234888 1:116771570-116771592 GATGTCACACAGTGTCAGACAGG - Intergenic
913342008 1:117767915-117767937 AAAGACACAGACTGGCAGATTGG - Intergenic
913987740 1:143581210-143581232 AAAGGCACAGACTGGCAAATTGG - Intergenic
915011715 1:152693078-152693100 AAAGGCACAGACTGGCAAATTGG + Intergenic
915617998 1:157056100-157056122 GAAGGCAGAGATTGTCAGACTGG - Intergenic
915644245 1:157256107-157256129 AAAGGCACAGACTGGCAAATTGG + Intergenic
915753133 1:158230985-158231007 AAAGGCACAGAGTGGCTGAATGG + Intergenic
915761516 1:158318615-158318637 GAAGACACAGACTGGCAAATTGG - Intergenic
915975881 1:160388551-160388573 AAAGACACAGACTGTCAAATTGG - Intergenic
916372846 1:164118812-164118834 AAAGGCACAGACTGGCAAATTGG + Intergenic
916392706 1:164348305-164348327 AAAGGCACAGGGTGGCAAATTGG + Intergenic
916614635 1:166427408-166427430 AAAGACACAGACTGGCAGATTGG - Intergenic
916633279 1:166639510-166639532 AAAGGCACAGAGTGACAAGTTGG + Intergenic
916673775 1:167048450-167048472 AAAGGCAGAGATTGTCAGAATGG + Intergenic
916740513 1:167643307-167643329 GAAGGCAAAGAGGGTGACATTGG + Intronic
917011300 1:170475858-170475880 AAAGGCAGAGATTGTCACATTGG + Intergenic
917173084 1:172199856-172199878 CAAGGCACAGAGTGGCAAAGTGG - Intronic
917821010 1:178764415-178764437 AAAGGCACAGAGTGGCAAACTGG - Intronic
917894284 1:179472949-179472971 AAAGGCAGAGATTGTCAGACTGG - Intronic
917895947 1:179487008-179487030 AAAGGCACAGAGTGGCAAGTTGG + Intronic
918227647 1:182499625-182499647 AAAGGCACAGAGTGGCAGGCTGG - Intronic
918391747 1:184071817-184071839 AAGGGCAGAGATTGTCAGATTGG + Intronic
918515829 1:185361516-185361538 AAAGGCACAGAGTGGCAACTTGG + Intergenic
918941992 1:191012255-191012277 AAAGGCAGAGACTGTCAGAGAGG + Intergenic
919245730 1:194981116-194981138 AAAGGCACAGAGTGTCAATGTGG - Intergenic
920044880 1:203126783-203126805 GAAGGCAAAGAGAGTCAGGCTGG - Intronic
920083448 1:203395094-203395116 AAAGGCACAGATTGTCAGATTGG - Intergenic
920381330 1:205536238-205536260 AAAGGCTCAGAGGGTCAAATAGG + Intergenic
921003881 1:211072920-211072942 AAAGACACAGACTGTCAGACCGG + Intronic
921011070 1:211141959-211141981 AAAGGCACAGAGTGGCAAGTTGG - Intergenic
921038480 1:211406244-211406266 AAAGGCACAGACTGGCAAATTGG - Intergenic
921236963 1:213142322-213142344 AAAGGCACAGAGTGGCAAGTTGG - Intronic
921241988 1:213194255-213194277 GAAGACACAGAGTGGCTGAATGG - Intronic
921257955 1:213359508-213359530 GAAGACACAGACTGGCAAATTGG - Intergenic
921738071 1:218651721-218651743 AAAGGCACAGACTGGCAAATTGG - Intergenic
921885975 1:220306533-220306555 AGAGGCAAAGATTGTCAGATTGG + Intergenic
921915814 1:220609506-220609528 AAAGACACAGAGTGGCAAATTGG - Intronic
921967946 1:221112595-221112617 AAAGGCAGAGATTGTCAGATTGG - Intergenic
922139901 1:222873725-222873747 AAAGGCACAGACTGGCAAATTGG - Intronic
922692132 1:227701824-227701846 AAAGGCACAGACTGGCAAATTGG + Intergenic
922848359 1:228708848-228708870 AAAGACACAGACTGTCAAATTGG + Intergenic
922971565 1:229745886-229745908 AAAGGCACAGAGTGGCAAGTTGG - Intergenic
923072788 1:230581262-230581284 GAAGCCCCAGAATGTCAGCTGGG - Intergenic
923768685 1:236917640-236917662 AAATGCAGAGATTGTCAGATTGG + Intergenic
923947235 1:238901311-238901333 AAAGACACAGAGTGGCAAATTGG + Intergenic
924392941 1:243582799-243582821 AAAGGCACAGAGTGGCATGTTGG + Intronic
924492868 1:244556454-244556476 AAAGGCAGAGATTGTCAGATTGG + Intronic
1062912928 10:1225363-1225385 AAAGGCACAGACTGGCAAATTGG - Intronic
1062918224 10:1258348-1258370 AAAGGCACAGACTGGCAAATTGG + Intronic
1063328366 10:5128477-5128499 GAAGACACAGAATGGCAGAATGG + Intronic
1064531104 10:16310633-16310655 AAAGGCAGAGATTGTCATATTGG + Intergenic
1064958704 10:20939624-20939646 AAAGGCACAGACTGGCAAATTGG + Intronic
1065098116 10:22302843-22302865 GAAGGAAAAGAGAATCAGATAGG - Intergenic
1065273876 10:24066094-24066116 AAAGGCACAGACTGGCAAATTGG - Intronic
1065477105 10:26151615-26151637 AAAGGCAGAGATTGTCAGACTGG - Intronic
1065992279 10:31023878-31023900 GGAAGCACAGAGTTTGAGATTGG - Intronic
1066060259 10:31717628-31717650 AAAGACACAGAGTGGCAAATTGG - Intergenic
1066499851 10:35981971-35981993 AAAGTCAGAGAGTGTTAGATGGG - Intergenic
1066582517 10:36896884-36896906 AAAGGCACAGACTGGCAAATTGG - Intergenic
1066639406 10:37540126-37540148 AAAGGCACAGACTGGCAAATTGG + Intergenic
1067172367 10:43918704-43918726 AAAGGCACAGACTGGCAAATTGG - Intergenic
1068093818 10:52465663-52465685 GAAGGGAGAGAGTGGGAGATGGG + Intergenic
1068115582 10:52734329-52734351 AAAGACACAGACTGTCAAATTGG - Intergenic
1068227185 10:54120454-54120476 AAAGGCACAGAGTGGCAAGTTGG + Intronic
1068367118 10:56066210-56066232 ACAGGCACAGAGTGGCAAATTGG - Intergenic
1068384590 10:56308958-56308980 AAAGGCACAGAGTGTCCAGTTGG - Intergenic
1068575384 10:58678236-58678258 AAAGGCACAGACTGGCAAATTGG + Intronic
1069228188 10:65970465-65970487 AAAGGCACAGAGTGGCAAGTTGG + Intronic
1069618388 10:69820759-69820781 GAGGGAACACAGTGACAGATGGG - Intronic
1070047746 10:72855796-72855818 AAAGGCAGAGATTGTTAGATTGG + Intronic
1070064900 10:73023686-73023708 AAAGGCACAGACTGGCAAATTGG + Intronic
1070244471 10:74717688-74717710 AAAGGCATAGAGTGTCTGAATGG - Intergenic
1070314961 10:75301153-75301175 AAAGGCAGAGATTGTCAGACTGG - Intergenic
1070555242 10:77522335-77522357 TAAGGAAAAGAGTGTCAGCTGGG - Intronic
1070710645 10:78680446-78680468 AAAGGCACAGACTGGCAAATTGG - Intergenic
1071005896 10:80883636-80883658 AAAGGCACAGACTGGCAAATTGG + Intergenic
1071022903 10:81080411-81080433 AAAGGCACAGAGTGGCAAGTTGG - Intergenic
1071039485 10:81288882-81288904 AAAGGCACAGAGTGGCAAGTTGG + Intergenic
1071171033 10:82864122-82864144 GGGGGCACAGAGTTTCTGATTGG + Intronic
1071209902 10:83328493-83328515 AAAGGCAGAGATTGTCAGAATGG - Intergenic
1071705189 10:87990290-87990312 AAAGGCAGAGATTGTTAGATTGG + Intergenic
1072032234 10:91531821-91531843 GAAGACACAGACTGGCAAATTGG + Intergenic
1072368747 10:94742832-94742854 AAAGGCACAGAGTGGCAAGTTGG - Intronic
1072388580 10:94958584-94958606 AAAGACACAGAGTGGCAAATTGG - Intronic
1072500288 10:96009225-96009247 AAAGGCAGAGATTGTCAGAGTGG - Intronic
1072833685 10:98687890-98687912 AAAGGCAAAGATTGTCAGACTGG - Intronic
1073605334 10:104889303-104889325 AAAAGCAAAGATTGTCAGATCGG - Intronic
1073783997 10:106867898-106867920 AAAGGCACAGAGTGTCAAGCTGG + Intronic
1073860204 10:107730220-107730242 AAAGGCACAGAGTGGCAAATTGG - Intergenic
1073916208 10:108407512-108407534 TAAGGCAGAGCTTGTCAGATTGG + Intergenic
1073929105 10:108554248-108554270 AAAGACACAGACTGTCAGATTGG + Intergenic
1073944911 10:108739507-108739529 AAAGGCACAGAGTGACAAGTTGG - Intergenic
1074114740 10:110447295-110447317 GAAGGGACACAGAGTCAGCTAGG + Intergenic
1074179434 10:111045316-111045338 AAAGGCACAGACTGGCAAATTGG + Intergenic
1074194764 10:111173663-111173685 AAAGGCACAGAGTGACAAGTTGG - Intergenic
1074196662 10:111193905-111193927 AAAGGCAGAGATTGTCAAATTGG - Intergenic
1075175186 10:120153813-120153835 AAAGGCACAGACTGACAAATTGG - Intergenic
1075224636 10:120616489-120616511 AAAGGCAGAGATTGTCAGAGTGG + Intergenic
1075805152 10:125182905-125182927 AAAGGCACAGACTGGCAAATTGG - Intergenic
1077586213 11:3455449-3455471 GCAGGAACAGAGTGTAAGAAAGG - Intergenic
1077661947 11:4076968-4076990 AAAGGCAAAGATTGTCAGATTGG + Intronic
1077947424 11:6916804-6916826 AAAGGCAGTGATTGTCAGATTGG - Intergenic
1078430169 11:11282229-11282251 GAAGGCACTGAGTGTGGGAAAGG - Intronic
1078570628 11:12454716-12454738 GCAGGGGCAGAGGGTCAGATGGG - Intronic
1078695431 11:13626982-13627004 AAAGGCACAGACTGGCAAATTGG - Intergenic
1078711604 11:13797780-13797802 AAAGGCACAGACTGGCAAATTGG - Intergenic
1078819588 11:14863995-14864017 AAAGGCACAGACTGGCAAATTGG + Intronic
1078887283 11:15515516-15515538 AAAGGCAGAGATTGACAGATTGG - Intergenic
1078959278 11:16245875-16245897 AAAGGCAGAGATTATCAGATTGG - Intronic
1079113229 11:17619344-17619366 AAAGGAAGAGATTGTCAGATTGG - Intronic
1079286411 11:19137106-19137128 AAAGGCACAGACTGGCAAATTGG + Intronic
1079300848 11:19277695-19277717 GAGGGCAAAGGGTGTCAGGTCGG + Intergenic
1079357577 11:19742812-19742834 GAAGGCACAGACAGGCAGACAGG + Intronic
1079806335 11:24934710-24934732 ATAGGCACAGCGTGTCAGATTGG - Intronic
1079977190 11:27106281-27106303 AAAGGCACAGACTGGCAAATTGG + Intronic
1080291465 11:30675778-30675800 AAAGGCACAGACTGGCAAATTGG + Intergenic
1081094737 11:38919282-38919304 AAAGGCACAGACTGGCAAATTGG - Intergenic
1081252116 11:40849092-40849114 AAAGGCACAGACTGGCAAATTGG - Intronic
1081377714 11:42378990-42379012 AAAGGCACAGACTGGCAAATTGG + Intergenic
1082298471 11:50474356-50474378 GAAGACACAGACTGGCAAATTGG - Intergenic
1082599780 11:55134884-55134906 GAAGACACAGACTGGCAAATTGG + Intergenic
1082613641 11:55333231-55333253 GAAGACACAGACTGGCAAATTGG - Intergenic
1082647789 11:55749571-55749593 AAAGGCACAGACTGGCAAATTGG + Intergenic
1082903399 11:58281283-58281305 AAAGGCACAGACTGGCAAATTGG - Intergenic
1082935137 11:58647971-58647993 GAATGCCCAGAGTGTGAGAGGGG - Intronic
1082956430 11:58875241-58875263 AAAGGCACAGACTGGCAAATTGG - Intronic
1083098037 11:60272828-60272850 AAAGGCACAAAGTGGCAAATTGG - Intergenic
1083135520 11:60671348-60671370 AAAGGCAGAGATTGTCAGATTGG - Intergenic
1083139300 11:60708622-60708644 GAAGACACAGAGGGTCAGGATGG - Intronic
1083513527 11:63234589-63234611 AAAGGCACAGACTGGCAAATTGG - Intronic
1083524358 11:63348362-63348384 AAAGACACAGAGTGGCAAATTGG - Intronic
1083530913 11:63420894-63420916 AAAGACACAGAGTGGCAAATTGG + Intergenic
1083532076 11:63432478-63432500 AAAGACACAGAGTGGCAAATTGG + Intergenic
1085343635 11:75750667-75750689 AAAGGCACAGACTGGCAAATTGG + Intergenic
1085797394 11:79554706-79554728 AAAGGCACAGACTGGCAAATTGG + Intergenic
1085812977 11:79702481-79702503 AAAGGCACAGAGTGGCAAACTGG + Intergenic
1085909101 11:80799989-80800011 AAAGACACAGACTGGCAGATTGG + Intergenic
1085966830 11:81538240-81538262 AAAGGCACAGACTGGCAAATTGG - Intergenic
1086142646 11:83516476-83516498 AAAGGCACAGACTGGCAAATTGG - Intronic
1086293207 11:85335367-85335389 AAAGGCAAAGAGTGGCAAATTGG - Intronic
1086755828 11:90560353-90560375 AAAGGCACAGAGTGGAAAATTGG + Intergenic
1086874148 11:92074710-92074732 AAAGGCACAGACTGGCAAATTGG + Intergenic
1087238249 11:95745662-95745684 AAAGTCAAAGATTGTCAGATTGG - Intergenic
1087753922 11:102035380-102035402 AAAGACACAGACTGGCAGATTGG - Intergenic
1087918145 11:103833614-103833636 AAAGGCACAGAGTGGCAAGTTGG + Intergenic
1088083507 11:105949825-105949847 GAAGGCAGAGAGAATCAGCTTGG + Intronic
1088099691 11:106142177-106142199 GAAGGCAGAGAGTCCCACATAGG - Intergenic
1088412637 11:109552231-109552253 GTAGGTAAAGAGTATCAGATAGG + Intergenic
1088698058 11:112386514-112386536 AAAGACAAAGATTGTCAGATTGG - Intergenic
1088948101 11:114535472-114535494 AAAGGCACAGACTGGCAAATTGG + Intronic
1089091421 11:115880530-115880552 AAAGGCACAGACTGGCAAATTGG - Intergenic
1089593846 11:119562287-119562309 AAAGGCACAGAGTGGCAAATTGG + Intergenic
1089765802 11:120764395-120764417 AAAGGCACAGACTGGCAAATTGG - Intronic
1090105205 11:123846735-123846757 AAACCCACAGAATGTCAGATTGG + Intergenic
1090217426 11:124982241-124982263 AAAGGCACAGAGTGGCAAGTTGG - Intronic
1090359207 11:126160973-126160995 GAAGGAAAAGAGTTTCAGAACGG + Intergenic
1091012654 11:132019801-132019823 AAAGGCAAAGATTGTCAGATTGG - Intronic
1091307607 11:134547157-134547179 AAAGACAAAGAGTGTCAGAGTGG + Intergenic
1091604886 12:1941979-1942001 AAAGACACAGAGTGGCAAATTGG + Intergenic
1091630294 12:2154748-2154770 AAAGGCACAGAATGTCTGATCGG + Intronic
1092638380 12:10476920-10476942 AAAGACACAGACTGGCAGATTGG - Intergenic
1093051390 12:14508854-14508876 GAAGAAACAGAGTTTCAGAGAGG + Intronic
1093501475 12:19816680-19816702 AAAGGCACAGACTGGCAAATTGG + Intergenic
1093627156 12:21362589-21362611 GAAGACACAGACTGGCAAATTGG + Intronic
1093649360 12:21625515-21625537 GAAGACACAGACTGGCAAATTGG - Intergenic
1093835386 12:23823067-23823089 AAAGGCACAGACTGGCAAATTGG - Intronic
1094190447 12:27692603-27692625 GAAGGGACAGTGAGACAGATAGG + Exonic
1094290028 12:28837205-28837227 AAAGGCACAGAGTGGCAAGTTGG + Intergenic
1094333795 12:29324939-29324961 AAAGGCACAGACTGGCAAATTGG + Intronic
1094408126 12:30140531-30140553 AAAGGCAAAGATTGTCAGATTGG + Intergenic
1094781846 12:33800798-33800820 AAAGGCACAGACTGGCAAATTGG - Intergenic
1095297449 12:40543015-40543037 TAAGGCACAGAGAATCAGTTGGG + Intronic
1095720420 12:45394035-45394057 AAAGACACAGACTGGCAGATTGG + Intronic
1095834243 12:46619672-46619694 AAAGACACAGACTGGCAGATTGG + Intergenic
1095868398 12:46997975-46997997 AAAGGCAGAGATTGTCAGATTGG + Intergenic
1095915856 12:47477247-47477269 AAAGGCACAGAGTGGCAAGTTGG + Intergenic
1095993376 12:48054833-48054855 AGAGGCAGAGATTGTCAGATTGG - Intronic
1095998682 12:48111325-48111347 GAAGGTACAGAGGATCAGAAGGG - Intronic
1096346537 12:50852231-50852253 TAAGGCACAGAGTGGCAAGTTGG + Intronic
1096428443 12:51523515-51523537 GAAGACACTGAGTCTCAGAGAGG + Intergenic
1096925367 12:55138391-55138413 AAAGGCACAGAGTGGCATGTTGG + Intergenic
1097075770 12:56392522-56392544 AAAGGCAAAGATTGTCAGATTGG + Intergenic
1098057522 12:66523718-66523740 GAAGACACAGACTGGCAAATTGG + Intronic
1098347659 12:69523526-69523548 AAAGGCACAGAGTGGCAAACTGG - Intronic
1098421498 12:70303168-70303190 AAAGGCACAGACTGGCAAATTGG - Intronic
1099010768 12:77288385-77288407 AAAGGCACAGACTGGCAAATTGG + Intergenic
1099512260 12:83553065-83553087 AAAGGCACAGACTGGCAAATTGG - Intergenic
1099697649 12:86042260-86042282 AAAGGCACAAAGTGGCAGGTTGG - Intronic
1099767463 12:87006372-87006394 AAAGGCACAGAGTGGCAAGTTGG - Intergenic
1100115885 12:91303553-91303575 AAAGGCACAGAGTGGCAAGTTGG + Intergenic
1100564032 12:95777351-95777373 AAAGGCACAGACTGGCAAATTGG + Intronic
1100579713 12:95927490-95927512 AAAGGCACAGACTGGCAAATTGG - Intronic
1100627030 12:96345978-96346000 AAAGGCAGAGATTGTCAGACTGG + Intronic
1100768508 12:97896244-97896266 AAAGACACAGACTGGCAGATTGG - Intergenic
1101202108 12:102447670-102447692 AAAGGCACAGACTGGCAAATAGG - Intronic
1101206374 12:102492369-102492391 AAAGGCACAGACTGGCAAATTGG - Intergenic
1101913239 12:108876739-108876761 GGAGGAACAGGGTGTCAGTTGGG - Intronic
1102405934 12:112674300-112674322 GAAGGCTCAGAGACTCAGAGCGG + Intronic
1103030482 12:117608149-117608171 GAAGACACTGAGGGTCAGAGAGG - Intronic
1103039924 12:117686405-117686427 GAAGAAACAGAGGGTCAGAGAGG + Intronic
1104156116 12:126134492-126134514 AAAGGCACAGAGTGGCAATTTGG - Intergenic
1104695195 12:130858202-130858224 AAAGGTACAGATTTTCAGATGGG - Intergenic
1105566479 13:21553723-21553745 AAAGGCACAGACTGACAAATTGG + Intronic
1105992818 13:25639292-25639314 AAAGGCACAGACTGGCAAATTGG + Intronic
1106018971 13:25896985-25897007 AAAGGCACAGACTGGCAAATTGG - Intronic
1106326110 13:28692023-28692045 AAAGACACAGACTGTCAAATTGG - Intergenic
1106357495 13:28997842-28997864 AAAGGCACAGACTGGCAAATTGG - Intronic
1106646864 13:31644399-31644421 AAAGTCACAGATTGTCAGACTGG + Intergenic
1106757158 13:32833882-32833904 AAAGGCAGAGACTGTCAGATTGG - Intergenic
1106860183 13:33897612-33897634 AAAGGCATAGAGTGGCAGAAGGG + Intronic
1106936316 13:34725261-34725283 AAAGGCAGAGATTATCAGATTGG + Intergenic
1106965898 13:35066717-35066739 AAAGGCAGAGATTGTCAGACTGG - Intronic
1107335982 13:39355575-39355597 GAAGGTACAGAGTGGCAAGTTGG + Intronic
1107648390 13:42518469-42518491 AAAGGCACAGACTGGCAAATTGG + Intergenic
1108307819 13:49156472-49156494 AAAGGCACAGACTGGCAAATTGG - Intronic
1108371007 13:49768398-49768420 AAAGGCAGAGATTGTCAGACTGG - Intronic
1109095193 13:58105519-58105541 CAAGGCACAGAGTGGCAAGTTGG - Intergenic
1109105311 13:58242405-58242427 GAAGGCACAGAGTGGCAAGTTGG + Intergenic
1109113259 13:58350509-58350531 AAAGGCACAGACTGGCAAATTGG - Intergenic
1109293925 13:60506894-60506916 AAAGGCACAGACTGGCAAATTGG + Intronic
1109329309 13:60907993-60908015 AAAGGTACAGAGTTTCAGTTAGG + Intergenic
1109465619 13:62728150-62728172 AAAGGCACAGACTGGCAAATTGG - Intergenic
1109483914 13:62994377-62994399 GAAGACACAGAATGGCAGAATGG - Intergenic
1109569105 13:64162990-64163012 AAAGGCACAGAATGGCAAATTGG - Intergenic
1109598829 13:64595810-64595832 AAAGGCACAGAGTGTCAAGCTGG + Intergenic
1109669635 13:65587353-65587375 AAAGGCACAGACTGGCAAATTGG + Intergenic
1109731778 13:66421848-66421870 AAAGGCACAGACTGGCAAATTGG + Intronic
1109814232 13:67558812-67558834 CAAGGCAGAGATTGTCACATTGG + Intergenic
1109884305 13:68523697-68523719 AAAGGCACAGACTGGCAAATTGG + Intergenic
1110060861 13:71035731-71035753 AAAGGCACAGAGTGACAAGTTGG + Intergenic
1110415239 13:75245104-75245126 AAAGGCACAGACTGGCAAATTGG - Intergenic
1110767986 13:79302096-79302118 GAAGACACAGACTGGCAAATTGG + Intergenic
1110915368 13:81014380-81014402 AAAGGCACAGAGTGGCAGGATGG - Intergenic
1111215056 13:85130702-85130724 AAAGGCAGAGATTATCAGATTGG + Intergenic
1111346379 13:86960190-86960212 AAAGGCAAAGATTGTAAGATTGG + Intergenic
1112590475 13:100759661-100759683 AAAGACACAGAGAGACAGATGGG + Intergenic
1112858507 13:103801211-103801233 GAAGTCAGAGAGTCTCAGAGTGG + Intergenic
1113410207 13:110079325-110079347 AAAGACACAGAGTGGCAAATTGG + Intergenic
1113736516 13:112682439-112682461 ATAGGCACAGAGTTTCAGTTTGG - Intronic
1113773555 13:112928898-112928920 GATGCCACAGACTGTCAGCTGGG - Intronic
1114074621 14:19150963-19150985 AAAGGCAGAGATTGTCAGACTGG - Intergenic
1114087646 14:19249012-19249034 AAAGGCAGAGATTGTCAGACTGG + Intergenic
1114172046 14:20282224-20282246 AAAGGCACAGACTGGCAAATTGG + Intronic
1114749362 14:25185590-25185612 AAAGGCACAGACTGGCAAATTGG + Intergenic
1114989284 14:28267158-28267180 AAAGGCACAGAGTGGCAAACTGG + Intergenic
1115391013 14:32855114-32855136 CAAGGCACAGACTGGCAAATTGG - Intergenic
1115743404 14:36411574-36411596 GAAGACACAGACTGGCAAATTGG + Intergenic
1115743684 14:36413886-36413908 GAAGACACAGACTGGCAAATTGG + Intergenic
1115890735 14:38025358-38025380 AAAGGCACAGAGTGACAAGTTGG + Intronic
1115911937 14:38266894-38266916 AAAGACACAGACTGGCAGATTGG - Intergenic
1116401569 14:44514139-44514161 AAAGGCACAGACTGGCAAATTGG - Intergenic
1116580529 14:46635731-46635753 AAAGGCCGAGAGTGTCAAATAGG - Intergenic
1116668857 14:47815605-47815627 CAAGATACAGAGTGGCAGATTGG - Intergenic
1116840569 14:49817058-49817080 AAAGGCAAAGACTGTCAGACTGG + Intronic
1117310352 14:54515861-54515883 AAAGGCAAAGATTATCAGATTGG - Intronic
1117614968 14:57525413-57525435 AAAGGCACAGAATGGCAGAATGG - Intergenic
1117849845 14:59956589-59956611 AAAGGCACAGACTGGCAAATTGG - Intronic
1118646365 14:67845054-67845076 TAAGGCACAGAGTGGCAAGTTGG - Intronic
1118964723 14:70569464-70569486 AAAGACACAGAGTGGCAAATTGG + Intergenic
1119689450 14:76659946-76659968 GAAGTGACAGAGTGACAGAAAGG - Intergenic
1120449825 14:84653469-84653491 AAAGGCACAGACTGGCAAATTGG - Intergenic
1120619705 14:86748953-86748975 GAAGACACAGACTGGCAAATTGG - Intergenic
1120675534 14:87417507-87417529 AAAGGCACAGACTGGCAAATTGG - Intergenic
1120848493 14:89147435-89147457 GCAGGGGCACAGTGTCAGATGGG + Intronic
1120963480 14:90146719-90146741 GAAGGCACTGATTGTCAGATTGG - Intronic
1121065162 14:90956460-90956482 AAAGGCAGAGATTGTCAGACTGG - Intronic
1121520650 14:94583998-94584020 GAAGAAACAGAGGGTCAGAGAGG - Intronic
1121953891 14:98196906-98196928 GAAAGCTCAGAGTGTCATCTTGG - Intergenic
1122586178 14:102808125-102808147 GAGGGCACAGAGAGTCACTTTGG + Intronic
1202883137 14_KI270722v1_random:80338-80360 AAAGGCACAGACTGGCAAATTGG - Intergenic
1123775445 15:23574871-23574893 GCAGGCACACAGTGTGAGATTGG + Intronic
1123883479 15:24698324-24698346 AAAGACACAGATTGTCAGAGTGG - Intergenic
1124127953 15:26955321-26955343 AAAGGCAGAGAATGTCAGACTGG + Intergenic
1124131270 15:26988591-26988613 AAAGGCAGAGATTGTTAGATTGG - Intronic
1124242307 15:28038856-28038878 AAAGGCAAAGAGTGGCAGAATGG + Intronic
1124479451 15:30065100-30065122 GCAGGTACAGACTGTCTGATAGG - Intergenic
1124506169 15:30276163-30276185 AAAGGCAGAGATTTTCAGATTGG + Intergenic
1124581391 15:30958271-30958293 GAAGGCACGGAGTGCCAGTGAGG + Intronic
1124737386 15:32262469-32262491 AAAGGCAGAGATTTTCAGATTGG - Intergenic
1125055510 15:35355237-35355259 GAAGACACAGACTGGCAAATTGG - Intronic
1125058375 15:35389793-35389815 AAAGGCACAGACTGGCAAATTGG - Intronic
1125078141 15:35644636-35644658 AAAGGCACAGAGTGGCAAGTTGG + Intergenic
1125130280 15:36276668-36276690 AAAGGCACAGAGTGGCAAGTTGG - Intergenic
1125232939 15:37477615-37477637 TAAGGCAGAGATTGTCAGACTGG + Intergenic
1125500651 15:40238731-40238753 GAAGGCTGAGAGTGGCACATGGG - Intergenic
1126284356 15:46994735-46994757 AAAGTCACAGAGTGGCAAATTGG - Intergenic
1126348986 15:47724989-47725011 GAAGCCACAGACTTTCAGTTTGG - Intronic
1126470533 15:49005704-49005726 AAAGACACAGACTGTCAAATTGG - Intronic
1126537991 15:49788859-49788881 AAAGGCAGAGATTGTCAGAGTGG - Intergenic
1127330868 15:57938865-57938887 AAAGGCACAGAGTGGCAAACTGG - Intergenic
1127527266 15:59805524-59805546 AAAGACACAGAGTGGCAAATTGG + Intergenic
1127573771 15:60270611-60270633 GAAGGTACAGAATGGCAGATTGG - Intergenic
1127934222 15:63620945-63620967 AAAGGCACAGACTGGCAAATTGG - Intronic
1128384482 15:67137786-67137808 GAAGGCCCATAGGGTCAGAATGG + Intronic
1128406407 15:67344834-67344856 AAAGACAGAGATTGTCAGATTGG + Intronic
1128968350 15:72084423-72084445 AAAGGCACAGAGTGAGAAATTGG - Intronic
1129128696 15:73470071-73470093 AAAGGCAGAGGTTGTCAGATTGG - Intronic
1129334048 15:74842036-74842058 CAAGGGACAGAGTGTCAGGCTGG + Intronic
1129563443 15:76595017-76595039 GAAGACACAGACTGGCAAATTGG + Intronic
1129584864 15:76851876-76851898 AAAGGCACAGAGTGGCAAGTTGG + Intronic
1129631187 15:77262299-77262321 GAAGACACAGACTGGCAAATTGG + Intronic
1129642666 15:77396462-77396484 AAAGACACAGAGTGGCAGAAAGG + Intronic
1130174831 15:81557639-81557661 AAAGGCACAGAGTGTCAAGTTGG - Intergenic
1130359304 15:83167063-83167085 AAAGGCACAGAGTGGCAGCTTGG + Intronic
1130580286 15:85131234-85131256 AAAGCCACAGACTGTCAGAATGG - Intronic
1130947268 15:88558193-88558215 AAAGGCACAGACTGGCAAATTGG - Intergenic
1130964101 15:88684493-88684515 GAAAGCACAGAGTGGGAGAGAGG - Intergenic
1131228179 15:90642283-90642305 GAAGCCACAGTGTCTGAGATGGG - Exonic
1131325674 15:91441234-91441256 AAAGGCACAGATTGTCAAACTGG + Intergenic
1131606731 15:93912651-93912673 GAAGGAACAGAGTGTCATTCTGG - Intergenic
1131918195 15:97294121-97294143 AAAGGCACAGACTGGCAAATTGG - Intergenic
1131943287 15:97591309-97591331 GAAGGAACTGAGTATCAGAGAGG - Intergenic
1132200149 15:99947115-99947137 AAAGGCATAGATTGTCAGAATGG - Intergenic
1132334865 15:101041306-101041328 AAAGGCAGAGATTATCAGATTGG - Intronic
1133754047 16:8748953-8748975 AAAGGCAGAGATTGTCAGACTGG - Intronic
1133938744 16:10290661-10290683 AAAGGCACAGACTGGCAAATTGG - Intergenic
1134666897 16:16025287-16025309 GAAGACACTGAGGGTCAGAGTGG + Intronic
1134676143 16:16091773-16091795 GAAGCCACTGAGTGTCAGAGAGG + Intronic
1135398679 16:22150430-22150452 GAAGACACAGAGGCTCAGAGAGG + Intronic
1136600352 16:31282670-31282692 AAAGGCACAGACTGGCAAATTGG - Intronic
1136603014 16:31309604-31309626 AAAGGCACAGACTGGCAAATTGG - Intronic
1136606782 16:31340060-31340082 AAAGGCACAGACTGGCAAATTGG + Intergenic
1136855305 16:33650950-33650972 AAAGACACAGAGTGGCAAATGGG + Intergenic
1136908707 16:34128084-34128106 AAAGGCACAGACTGGCAAATTGG - Intergenic
1137224063 16:46484792-46484814 GAAGGCACAGAGTGGCAAGCTGG + Intergenic
1137390542 16:48077614-48077636 GTGGGCACAGAGTTTCAGTTTGG + Intergenic
1137561330 16:49504123-49504145 ACAGGAACAGAGTTTCAGATGGG + Intronic
1137769861 16:51007505-51007527 AAAGGCACAGAGTGGCAAGTTGG + Intergenic
1137847495 16:51705330-51705352 AAAGGAAGAGATTGTCAGATTGG - Intergenic
1138258570 16:55594885-55594907 AAAGGCACAGAGTGGCAAGTTGG + Intergenic
1138679130 16:58672362-58672384 GGAGGCTCAGAGTGGGAGATGGG + Intronic
1138722544 16:59098583-59098605 AAAGGCACAGACTGGCAAATTGG + Intergenic
1139257164 16:65553301-65553323 AAAGGCACAGACTGGCAAATTGG + Intergenic
1139331202 16:66192249-66192271 AAACGCAGAGATTGTCAGATTGG + Intergenic
1140148035 16:72331452-72331474 AAAGGCACAGAATGGCAAATTGG - Intergenic
1141167223 16:81668811-81668833 GAAGGCAGTGAGTGTGAGGTGGG - Intronic
1141167228 16:81668838-81668860 GAAGGCAGTGAGTGTGAGGTGGG - Intronic
1141167233 16:81668865-81668887 GAAGGCAATGAGTGTGAGGTGGG - Intronic
1141245893 16:82307360-82307382 AAAGGCACAGACTGACAAATTGG - Intergenic
1203116890 16_KI270728v1_random:1499431-1499453 AAAGACACAGAGTGGCAAATGGG + Intergenic
1142911408 17:3096278-3096300 AAAGGCAGAGACTGTCAGAGTGG + Intergenic
1143171325 17:4932323-4932345 GAAGGCACAGAGCGTCTTCTAGG - Exonic
1143303257 17:5926715-5926737 GGTGGCACAGAGTCTCAGAAAGG + Intronic
1144951699 17:18997957-18997979 GAAGGAACAGAAGGTCAGAGAGG + Intronic
1147589179 17:41670381-41670403 GAAGGAACTGAGAATCAGATGGG + Intergenic
1148773065 17:50078007-50078029 GGAGGCAGAGAGTGGCATATGGG - Intronic
1148989998 17:51657558-51657580 CTAGGGACAGAGTATCAGATTGG + Intronic
1149193175 17:54087809-54087831 AAAGACACAGACTGTCAAATTGG + Intergenic
1149235244 17:54582220-54582242 AAAGGCACAGAGTGGCAAGTTGG + Intergenic
1149311253 17:55396338-55396360 AAAGGCAGAGATTGTCAGACTGG - Intronic
1149885973 17:60340621-60340643 AAAGGCACAGATTGGCAAATTGG - Intronic
1150511912 17:65762377-65762399 AAAGGCAGAGATTGTCAGAGTGG - Intronic
1150940356 17:69686607-69686629 AAAGGCACAGAGTGTCAAGCTGG - Intergenic
1150994609 17:70302637-70302659 GAAAACAGAGATTGTCAGATGGG - Intergenic
1151334469 17:73431866-73431888 GAGGGCACAGGGTCTCAGAGCGG + Intronic
1152288512 17:79425744-79425766 GAAGGGACAGAGCGGGAGATTGG + Intronic
1153094533 18:1385310-1385332 AAAGGCACAGAGTGGCAAACTGG + Intergenic
1153313195 18:3698137-3698159 AAAGACACAGAGTGGCAAATTGG - Intronic
1153462068 18:5346276-5346298 AAAGGCACAGAGTGGCAAGTTGG + Intergenic
1153531032 18:6045927-6045949 GAAGGCACAGAGTTGCAAATTGG + Intronic
1153899071 18:9599536-9599558 AAAGGCAGAGACTGTCAAATTGG + Intronic
1153907684 18:9677495-9677517 AAAGGCAAAGATTTTCAGATTGG - Intergenic
1154040907 18:10855072-10855094 TAAGACACAGAGTCTCAGCTGGG - Intronic
1154109343 18:11552433-11552455 GAAGCCACAGAGTGGCAGGGGGG + Intergenic
1154180902 18:12138995-12139017 AAAGGCACAGACTGGCAAATTGG - Intergenic
1154352447 18:13596313-13596335 AAAGGCAGAGACTGTCAGAATGG - Intronic
1155104780 18:22652268-22652290 GAAGGCAGACATTGTCAGATTGG - Intergenic
1155802569 18:30126809-30126831 GAAGACATAAATTGTCAGATTGG + Intergenic
1156188155 18:34688093-34688115 AAAGGCACAGACTGGCAAATCGG - Intronic
1157509219 18:48257053-48257075 AAAGGCAGAGACTGTTAGATTGG + Intronic
1158297451 18:56014498-56014520 AAAGGCACAGACTGGCAAATTGG - Intergenic
1158337400 18:56427904-56427926 AAAGGCACAGAGTGCCAAACTGG + Intergenic
1159143664 18:64426452-64426474 AAAGACACAGAGTGGCAAATTGG + Intergenic
1159231870 18:65618758-65618780 AAAGACACAGAGTGGCAAATTGG - Intergenic
1159499925 18:69255919-69255941 AAAGACACAGACTGTCAAATTGG + Intergenic
1159723437 18:71922145-71922167 AAAGGCACAGAGTGCCAAGTTGG + Intergenic
1160087675 18:75793162-75793184 AAAGGCAGAGATTGTCAGATTGG + Intergenic
1160344282 18:78119737-78119759 AAAGACAGAGATTGTCAGATTGG - Intergenic
1160476788 18:79197811-79197833 AAAGGCAGAGACTGTCAGACTGG + Intronic
1162284158 19:9725807-9725829 GATGGAACAGACTGCCAGATGGG - Intergenic
1162892318 19:13742766-13742788 AAAGGCACAGAATGTCATCTTGG - Intronic
1163550854 19:17965914-17965936 GATGGCTCAGAGTCTCAGACAGG - Intronic
1163940929 19:20492634-20492656 AAAGGCACAGACTGACAAATTGG + Intergenic
1163975087 19:20843180-20843202 AAAGGCACAGACTGGCAAATTGG + Intronic
1163976128 19:20854244-20854266 AAAGGCACAGACTGGCAAATTGG + Intronic
1164132947 19:22382626-22382648 AAAGACACAGACTGGCAGATTGG - Intergenic
1164329004 19:24233409-24233431 AAAGGCACAGACTGGCAAATTGG + Intergenic
1164944081 19:32276172-32276194 AAAAGCACAGATTGCCAGATAGG + Intergenic
1165154854 19:33780834-33780856 CAAGGCAGAGAGAGACAGATGGG - Intergenic
1165220511 19:34312411-34312433 GCAGGTACAGAGTTTCAGTTTGG - Intronic
1165270611 19:34704333-34704355 AAAGGCACAGACTGGCAAATTGG - Intergenic
1165283895 19:34821730-34821752 AAAGGCAGAGATTGTTAGATTGG + Intergenic
1165360403 19:35333103-35333125 GCAGGAACTGAGGGTCAGATGGG - Intronic
1165587827 19:36935907-36935929 AAAAGGACAGATTGTCAGATTGG - Intronic
1165776944 19:38410241-38410263 GAGGGCAGAGACTCTCAGATTGG - Intronic
1166854773 19:45778054-45778076 GAAGGCACAGAGTGTGGGAGCGG - Intronic
1168602504 19:57729464-57729486 AAAGGCACAGACTGGCAAATTGG + Intronic
1168638302 19:58013171-58013193 GAGGGCACAGAGGGTCAGGGAGG + Intergenic
1202658547 1_KI270708v1_random:47481-47503 AAAGGCACAGACTGGCAAATTGG - Intergenic
925327229 2:3032713-3032735 AAAGGCACAGACTGGCAAATTGG + Intergenic
925558379 2:5158390-5158412 TAAGGCAGAGATTGTCAGACTGG + Intergenic
925861371 2:8180047-8180069 AAAGGCAGAGATTGTTAGATTGG + Intergenic
926318314 2:11728297-11728319 AAAGACAGAGATTGTCAGATTGG - Intronic
926338661 2:11885408-11885430 AAAGGCACAGACTGGCAAATTGG - Intergenic
926427187 2:12749401-12749423 AAAGGCAGAGATTGTCAGATTGG - Intergenic
926483221 2:13425766-13425788 GAAGGCACAGACTGGCAAATTGG - Intergenic
926601489 2:14850118-14850140 AAAGGCACAGACTGGCAAATTGG + Intergenic
926992573 2:18696145-18696167 AAAGGCACAGACTGGCAAATAGG - Intergenic
927002033 2:18806510-18806532 TAAGGCAGATATTGTCAGATTGG + Intergenic
927210927 2:20638577-20638599 GATGGCACAGACAGTCAGACAGG - Exonic
927235818 2:20873800-20873822 AAAGGCACAGACTGGCAAATTGG - Intergenic
927239568 2:20909413-20909435 AAAGGCACAGACTGGCAGATTGG - Intergenic
927262709 2:21109484-21109506 AAAGACACAGTTTGTCAGATTGG - Intergenic
927437525 2:23081720-23081742 AAAGGCAGAGATTGTCAAATTGG - Intergenic
927444531 2:23146797-23146819 AAAGGCAGAGATTGTCAGATTGG + Intergenic
927456576 2:23255614-23255636 AAAGGCAGAGATTGTAAGATTGG + Intergenic
927534338 2:23842057-23842079 AAAGACAAAGATTGTCAGATTGG - Intronic
928321384 2:30285183-30285205 AAAGGCAGAGATTGTCAGATTGG - Intronic
928477066 2:31638861-31638883 AAAGGCACAGAGTGACTGAATGG - Intergenic
928489986 2:31772555-31772577 AAAGGCAGAGCTTGTCAGATTGG + Intergenic
928608584 2:32968566-32968588 AAAGGCAGAGACTGTCAGAGTGG - Intronic
928754394 2:34506790-34506812 AAAGGCACAGACTGGCAAATTGG + Intergenic
928799496 2:35069690-35069712 AAAGGCACAGAGTGGCAAGTTGG + Intergenic
928837642 2:35567015-35567037 AAAGGCACAGACTGGCAAATGGG - Intergenic
929097277 2:38275431-38275453 GAAGGCACAGATTGGAAGATAGG + Intergenic
929100275 2:38304966-38304988 AAAGGCACAGAGTGGCTGAATGG + Intronic
929319107 2:40519392-40519414 GAAGGCACAGAGTGTCAGATTGG - Intronic
929619888 2:43343714-43343736 GCAGGCACTGAGGGACAGATAGG - Intronic
929752866 2:44735293-44735315 AAAGGCAGAGTGTGTCAGACTGG - Intronic
930230454 2:48838599-48838621 AAAGGCACAGAGTGGCTGAATGG - Intergenic
930290073 2:49482515-49482537 AAAGGCACAGACTGGCAAATGGG + Intergenic
930546163 2:52769816-52769838 AAAGGCACAGAATGGCAGGTTGG + Intergenic
930612984 2:53563605-53563627 GAAGGCAGGGAGTGTCAGGTGGG - Intronic
930933169 2:56914452-56914474 AAAGGCACAGACTGGCAAATTGG - Intergenic
931109062 2:59090695-59090717 AAAGGCACAGACTGGCAAATTGG - Intergenic
931557545 2:63521248-63521270 AAAGGCATAGAGTGGCAGCTTGG + Intronic
931574534 2:63706247-63706269 AAAGGCACAGACTGGCAAATTGG - Intronic
931955169 2:67415849-67415871 GAAGGCAGAGATTGGCAGATTGG + Intergenic
931987046 2:67752166-67752188 GCAGGCACAGAGTGAAAGCTAGG + Intergenic
932362748 2:71122575-71122597 GCAGGCAAAGAGAGACAGATTGG + Intronic
932776990 2:74534315-74534337 GAAGACACTGAGTGTCAGGAGGG - Exonic
932867993 2:75367015-75367037 AAAGGCACAGAGTGGCAAGTTGG - Intergenic
933346931 2:81099146-81099168 GAATGCAGAGATTATCAGATTGG - Intergenic
933418409 2:82017529-82017551 AAAGGCAGAGATTGTCAGACTGG - Intergenic
933421893 2:82058892-82058914 AAAAGCACAGATTGTCAGATGGG - Intergenic
933801764 2:85965973-85965995 AAAGGCACAGACTGGCAAATTGG + Intergenic
934012382 2:87836774-87836796 AAAAGCACAGAGTGACAAATTGG + Intergenic
934790540 2:97056030-97056052 GAAGGCAGCGAGTGTAAGGTAGG - Intergenic
934815925 2:97326501-97326523 GAAGGCAGCGAGTGTAAGGTAGG + Intergenic
934821770 2:97381982-97382004 GAAGGCAGCGAGTGTAAGGTAGG - Intergenic
935020873 2:99230071-99230093 AAAGGCACAGAGTGGCAAGTTGG + Intronic
935119287 2:100167507-100167529 AAAGGCACAGATTCGCAGATGGG + Intergenic
935171405 2:100613619-100613641 GAAGGCACAGAGAGGCAGAAGGG - Intergenic
935306040 2:101737513-101737535 GATGGATCAGAGTGTGAGATTGG + Intronic
935491893 2:103731907-103731929 AAAGGCACAGAGTGGCAATTTGG - Intergenic
935822830 2:106911364-106911386 GAAGGCAAAGACTGGCAAATTGG + Intergenic
936668297 2:114624510-114624532 GAAGTCACTAAGTGACAGATGGG - Intronic
936762447 2:115803383-115803405 AAAGGCACAGACTGTCAAATTGG - Intronic
937248778 2:120510634-120510656 GACAACACAGAGTGTCAGAGGGG + Intergenic
937484674 2:122302341-122302363 AAAGGCACAGAGTGGCAACTTGG + Intergenic
937576047 2:123423380-123423402 AAAGGCACAGACTGGCAAATTGG - Intergenic
937874130 2:126808127-126808149 GAAGGCACAGGGTGACATTTAGG + Intergenic
938098589 2:128480226-128480248 AAAGGCAGAGATTGTCAGACTGG + Intergenic
938242060 2:129750204-129750226 AAAGACACAGAGTGGCAAATTGG + Intergenic
938488953 2:131747455-131747477 AAAGGCAGAGATTGTCAGACTGG - Intronic
939363433 2:141203229-141203251 AAAGACACAGAGTGGCAAATTGG + Intronic
939479466 2:142730035-142730057 AAAGGCACAGACTGGCAAATAGG + Intergenic
939544880 2:143540330-143540352 AAAGGCACAGACTGGCAAATTGG - Intronic
939640617 2:144636615-144636637 GAAGACACAGACTGGCAAATTGG - Intergenic
940253223 2:151702819-151702841 AAAGGCACAGACTGGCAAATTGG - Intronic
941726612 2:168867425-168867447 AAAGGCACAGACTGGCAAATTGG + Intronic
941731106 2:168919316-168919338 GAAGACAAAGAGAGTGAGATTGG - Intergenic
942258587 2:174133750-174133772 AAAGACAAAGAATGTCAGATTGG - Intronic
942331800 2:174833579-174833601 AAAGGCAGAGATTGTCAGGTTGG - Intronic
942898992 2:181091412-181091434 AAAGGCACAGACTGGCAAATTGG + Intergenic
943173444 2:184434406-184434428 GAAGGTACAGGGTGTCAGACAGG + Intergenic
943286759 2:186010971-186010993 AAAGGCACAGAGTGGCAAGTTGG + Intergenic
943351644 2:186803931-186803953 AAAGGCACACAGTGCCAGGTTGG - Intergenic
943577808 2:189652006-189652028 GAAGGCACAGAGTGGCAAGCTGG + Intergenic
943589007 2:189774918-189774940 GAAGGCCCAGAACATCAGATAGG + Intronic
943891821 2:193296999-193297021 AAAGGCACAGACTGGCAAATTGG + Intergenic
944033677 2:195267655-195267677 AAAGGCACAGACTGGCAAATTGG - Intergenic
944094573 2:195951882-195951904 AAAGACACAGACTGTCACATTGG - Intronic
944436766 2:199697821-199697843 AAAGGCAAAGAGTGTCAAGTTGG + Intergenic
944471500 2:200057803-200057825 AAAGGCATAGAGTGTCAAGTTGG + Intergenic
944788970 2:203104490-203104512 AAAGGCACAGAGTGGCAAGTTGG - Intronic
945124710 2:206495690-206495712 AAAGGCACAGACTGGCAAATTGG + Intronic
945171689 2:207002951-207002973 AAAGGCACAGACTGGCAAATTGG + Intergenic
945347599 2:208737224-208737246 AAAGGCACAGAGTGGCAAGTTGG - Intronic
945387205 2:209216637-209216659 AAAGGTACAGAATGTCAGAACGG + Intergenic
945409411 2:209490467-209490489 AAAGGCACAGACTGGCAAATTGG + Intronic
945486663 2:210405189-210405211 GAAGACACAGACTGGCAAATTGG - Intergenic
945667361 2:212758813-212758835 AAAGGCACAGACTGGCAAATTGG + Intergenic
945669650 2:212787297-212787319 AAAGGCACAGACTGGCAAATTGG + Intergenic
945761394 2:213920234-213920256 AAAGGCACAGAGTGGCAAATTGG - Intronic
945764932 2:213963970-213963992 TAAGGCAGAGATTGTCAGAAAGG - Intronic
946132174 2:217615114-217615136 GAAGGCACACAGGGTAAGAGGGG - Intronic
946316451 2:218917538-218917560 AATGGCACAGATTGTCAGTTTGG - Intergenic
946675878 2:222158708-222158730 GAAGGTAAAGAGGGTCACATGGG - Intergenic
946887334 2:224235331-224235353 AGAGGCAGAGATTGTCAGATAGG - Intergenic
947370117 2:229436987-229437009 AAAGGCACAGAGTGGCCGGTTGG + Intronic
947491278 2:230596497-230596519 GAAGTCACCGAGTGGCAAATTGG + Intergenic
948889620 2:240900696-240900718 GCAGGCACAGAGTCTCAGCCTGG - Intergenic
1168734419 20:118000-118022 AAAGGCACAGAGTGGCAAGTTGG + Intergenic
1169671146 20:8104205-8104227 AAAGGCACAGAATGGCAAATGGG - Intergenic
1170807351 20:19644177-19644199 GCAGGCACAGAGAGTCATCTGGG - Intronic
1171168136 20:22991543-22991565 AAAGGCACAGACTGGCAAATTGG - Intergenic
1171239964 20:23558622-23558644 AAAGGCACAGAGTAGCAAATTGG - Intergenic
1171386302 20:24771435-24771457 GAAGCCACAGGGAGTCAGAGAGG - Intergenic
1171772327 20:29332649-29332671 AAAGGCACAGACTGGCAAATGGG + Intergenic
1171904171 20:30886837-30886859 AAAGGCACAGACTGGCAAATTGG - Intergenic
1172894793 20:38292838-38292860 GAAGACACAGAGGGTCAGGGTGG - Intronic
1173071231 20:39768578-39768600 AAAGGCTGAGATTGTCAGATTGG - Intergenic
1173086076 20:39919540-39919562 AAAGGCACAGACTGGCAAATTGG - Intergenic
1173664926 20:44756687-44756709 GAAGGAACTGAGGGTCAGAAGGG + Intronic
1173894872 20:46543029-46543051 GAAGGCACAGAGAATGATATTGG + Intronic
1174768632 20:53276890-53276912 CAAAGGACAGAGTGTCAGACAGG - Intronic
1174861213 20:54093000-54093022 AAAGGCACAGATTGGCAGAATGG - Intergenic
1174995632 20:55565082-55565104 AAAGGCACAGAGTGGCAAATTGG - Intergenic
1175026053 20:55904179-55904201 AAAGACACAGAGTGGCAAATTGG - Intergenic
1175264474 20:57694246-57694268 GAAGGCTGAGAGTGTCATTTGGG - Intronic
1175269536 20:57724099-57724121 GAAGACACAGAGAGTCACACAGG - Intergenic
1175317644 20:58061030-58061052 AAAGGCAGAGATTGCCAGATTGG + Intergenic
1175781118 20:61682579-61682601 GAAGGGACAGAGGGAGAGATGGG + Intronic
1176168702 20:63687595-63687617 GAGGGCACAGAGTGTGAGGACGG - Intronic
1176638110 21:9268096-9268118 AAAGGCACAGACTGGCAAATTGG + Intergenic
1177294725 21:19160058-19160080 GACTGCACAGAATGTCGGATGGG + Intergenic
1177848973 21:26324180-26324202 GAAGGAACAGTGTGTCACTTAGG - Intergenic
1177934941 21:27333473-27333495 AAAGACACAGAGTGGCAGAATGG + Intergenic
1178965338 21:37111244-37111266 AAAGGCACAGACTGGCATATTGG + Intronic
1179378239 21:40872614-40872636 AAAGGCAAAGATTGTCAGACTGG + Intergenic
1179707664 21:43191626-43191648 GAAGGAACAGGGTGTCAGGTGGG + Intergenic
1180192381 21:46172122-46172144 GGATGCACAGAGTGTGAGGTGGG + Intronic
1180290269 22:10843903-10843925 AAAGGCAGAGATTGTCAGACTGG - Intergenic
1180317737 22:11290456-11290478 AAAGGCACAGACTGGCAAATTGG + Intergenic
1180326016 22:11430999-11431021 AAAGGCACAGACTGGCAAATTGG - Intergenic
1180337596 22:11592974-11592996 AAAGGCACAGACTGGCAAATTGG - Intergenic
1180370858 22:12035311-12035333 AAAGGCACAGATTGGCAAATTGG - Intergenic
1180394518 22:12318222-12318244 TAAGGCACAGACTGGCAAATTGG - Intergenic
1180405227 22:12546526-12546548 TAAGGCACAGACTGGCAAATTGG + Intergenic
1180414894 22:12699763-12699785 AAAGGCACAGACTGGCAAATTGG + Intergenic
1180422150 22:12875593-12875615 AAAGGCACAGACTGGCAAATTGG + Intergenic
1180493067 22:15873324-15873346 AAAGGCAGAGATTGTCAGACTGG - Intergenic
1180565745 22:16662539-16662561 AAAGGCACAGACTGGCAAATTGG + Intergenic
1181682367 22:24504276-24504298 GAAGGAACATATTTTCAGATGGG - Intronic
1181823565 22:25494714-25494736 AAAGGCATAGAGTGTGAAATAGG - Intergenic
1182322702 22:29488859-29488881 GAAGGTGAAGAGTGTCGGATTGG + Exonic
1182912721 22:34000068-34000090 AAAGGCAGAGATTGTCAGAATGG + Intergenic
1182971013 22:34576741-34576763 GAAGACAAAGATTGTCAGAGAGG - Intergenic
1183487321 22:38096035-38096057 GAAGACACAGACTGTAAGACTGG + Intronic
1183497461 22:38155870-38155892 AAAGACACAGAGTGGCAGAACGG + Intronic
1183763753 22:39850476-39850498 AAAGGCAGAGACTATCAGATTGG - Intronic
1184121854 22:42456020-42456042 AAAGGCAGAGATTGTCAGATTGG + Intergenic
1185258842 22:49850425-49850447 GGAGGCACAGGGTGGCAGAGGGG + Intergenic
949423296 3:3889553-3889575 AAAGGCACAGACTGGCAAATTGG - Intronic
949453537 3:4213602-4213624 AAAGGCACAGACTGGCAAATTGG + Intronic
949601412 3:5602141-5602163 CAAGGCACAGAGTGGCAAGTTGG + Intergenic
949631759 3:5935865-5935887 AAAGGCACAGACTGGCAAATTGG + Intergenic
949676542 3:6460765-6460787 AAAGGCAGAGACTGTCAGACTGG - Intergenic
950054271 3:10012270-10012292 GAAGGCAGACTTTGTCAGATGGG - Intergenic
950144423 3:10638656-10638678 AAAGGCAGAGATTGTCAGATTGG + Intronic
950305456 3:11912706-11912728 GAAGGCAGACTTTGTCAGATGGG - Intergenic
950489850 3:13297498-13297520 AGAGGCAGAGAGTCTCAGATAGG + Intergenic
950850739 3:16060047-16060069 GAAGGCAAAGGGTGGCAGTTGGG - Intergenic
951499065 3:23363340-23363362 AAAGGCACAGAATGACAGCTTGG + Intronic
951547169 3:23838413-23838435 AAAAGCAAAGATTGTCAGATTGG - Intronic
951601315 3:24379309-24379331 GAAGCCACAGACTGAGAGATAGG + Intronic
952225572 3:31372108-31372130 GAAGGCACTGAGTCGCAAATTGG - Intergenic
953079850 3:39606607-39606629 AAAGGCACAGAGTGGCAAACTGG - Intergenic
953185469 3:40633519-40633541 AAAGGTACAGAATGTCAGAATGG + Intergenic
953262598 3:41354220-41354242 GAAGGCAGGGAGTGACAGAGTGG - Intronic
953264502 3:41372830-41372852 AAAGGCACAGACTGGCAAATTGG + Intronic
953266621 3:41395648-41395670 ATAGGCACAGAGTTTCAGTTTGG + Intronic
953289307 3:41646144-41646166 AAAGACACAGACTGGCAGATTGG - Intronic
953310106 3:41868814-41868836 AAAGGCAGAGATTGTCATATTGG - Intronic
953376382 3:42431798-42431820 GCTGGCAGAGAATGTCAGATGGG - Intergenic
953585202 3:44193861-44193883 AAAGGCAGAGATTGTCAGACTGG + Intergenic
954491223 3:50907703-50907725 AAAGGCACAGACTGGCAAATTGG - Intronic
955338600 3:58107396-58107418 GAAGACACCAAGAGTCAGATAGG - Intronic
956006033 3:64778979-64779001 AAAGGCACAGACTGGCAAATTGG + Intergenic
957102745 3:75848947-75848969 AAAGGCACAGACTGGCAAATTGG - Intergenic
957742228 3:84285832-84285854 GAAGGCATAAAGTTTCTGATTGG + Intergenic
957981501 3:87517167-87517189 GAAGTCAAAGAGGGTCAGAGGGG - Intergenic
958067175 3:88558347-88558369 AAAGGCACAGACTGGCAAATTGG + Intergenic
958448236 3:94241089-94241111 AAAGGCACAGACTGGCAAATTGG - Intergenic
958520705 3:95182704-95182726 TAAGGCACAGAGTGGCAAATTGG - Intergenic
958586469 3:96093412-96093434 AAAGGCACAGACTGGCAAATTGG + Intergenic
958715597 3:97776384-97776406 GAAGACACAGAGTGGCTGAATGG - Intronic
958835345 3:99138996-99139018 AAAGGCACAGACTGGCAAATTGG - Intergenic
959257528 3:104033487-104033509 AAAGACACAGAGTGGCAAATTGG + Intergenic
959618212 3:108371515-108371537 AAAGACACAGAGTGGCAAATTGG + Intronic
959642558 3:108657679-108657701 AAAGACACAGAGTGGCAAATTGG + Intronic
959825374 3:110788810-110788832 AAAGGCACAGAGTGGCAAGTTGG - Intergenic
959828783 3:110834799-110834821 AAAGGCACAGACTGGCAAATTGG - Intergenic
959880995 3:111445056-111445078 AAAGACACAGACTGGCAGATTGG - Intronic
960012003 3:112843739-112843761 AAAGGCACAGAGTGGCAAGTTGG + Intronic
960017718 3:112911836-112911858 AAAGGCACAGACTGGCAAATTGG + Intergenic
960343155 3:116499528-116499550 AAAGGCATAGAGTGGCAAATTGG + Intronic
960756385 3:121018730-121018752 TAAGGCACAAAATGGCAGATAGG + Intronic
961977752 3:131044288-131044310 AAAGGCACAGACTGGCAAATTGG + Intronic
962861512 3:139406767-139406789 AAAGACACAGACTGTCAAATTGG + Intergenic
962874188 3:139523148-139523170 GAGGGCACAGAGACTCAGAGAGG - Intronic
963027003 3:140929956-140929978 GAATACACAGAGTGGCTGATAGG + Intergenic
963027667 3:140935549-140935571 AAAGGCACAGACTGGCAAATTGG + Intergenic
963048292 3:141120863-141120885 AAAGGCACAGACTGGCAAATTGG - Intronic
963050519 3:141139287-141139309 AAAGGCACAGACTGGCAAATTGG - Intronic
963318745 3:143789514-143789536 GAAGGCACTGAGGTACAGATTGG + Intronic
963615084 3:147526843-147526865 AAAGGCACAGAGTGGTAAATTGG - Intergenic
963978691 3:151511655-151511677 AAAGGCACAGACTGGCAAATTGG + Intergenic
964057766 3:152482632-152482654 GAAGGCACAGAGTGGCAAGTTGG - Intergenic
964371140 3:156002032-156002054 AAAGGCACAGAGTGGCAAACTGG - Intergenic
964486335 3:157188596-157188618 AAAGGCACAGAGTGGCAAGTTGG + Intergenic
964543155 3:157802472-157802494 AAAGGCACAGACTGGCAAATTGG - Intergenic
964919357 3:161877111-161877133 AAAGGCACAGAGTGGCAAGTAGG + Intergenic
965238818 3:166165308-166165330 AAAGGCACAGATTGTCAGACTGG - Intergenic
965886205 3:173450014-173450036 AAAGGCACAGACTGGCAAATTGG - Intronic
965939910 3:174167133-174167155 AAAGGCACAGAGTGACAAGTTGG - Intronic
966136792 3:176707728-176707750 AAAGGCACAGACTGGCAAATTGG + Intergenic
966291407 3:178363303-178363325 AAAGGCACAGACTGGCAAATTGG + Intergenic
966512486 3:180779687-180779709 AAAGGCACAGAGTGGCAAGTTGG - Intronic
966519954 3:180862529-180862551 TAAGGCAGATATTGTCAGATTGG + Intronic
966701096 3:182851841-182851863 GAAGTCAGAGATTGTCAGATTGG + Intronic
967109893 3:186283978-186284000 GAAGGCAAACAGAGTCAGACAGG - Intronic
967504770 3:190241170-190241192 AAAGGCACAGAATGGCAGAATGG + Intergenic
967896348 3:194398943-194398965 GAAGGCACAGAGGCACAGAAAGG + Intergenic
968211980 3:196856228-196856250 AAAGGCACAGGGTGTCAAGTTGG + Intergenic
1202748784 3_GL000221v1_random:136925-136947 AAAGGCACAGACTGGCAAATTGG - Intergenic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
969164593 4:5296715-5296737 CAAGGCACAGACTGGCAAATTGG - Intronic
969275547 4:6133526-6133548 GAAGGAACAGAGTTGCAGAGGGG - Intronic
969685977 4:8674549-8674571 GAAGGCACAGGGTGACAGTCAGG + Intergenic
970114162 4:12674709-12674731 AAAGGCAGAGATTGTCAAATTGG + Intergenic
970241946 4:14018643-14018665 GATGGTACAGAGAGTCTGATGGG + Intergenic
970278130 4:14424491-14424513 AAAGGCACAGACTGGCAAATTGG - Intergenic
970304894 4:14720918-14720940 AAAGGCACAGACTGGCAAATTGG + Intergenic
970413192 4:15830816-15830838 GAAGGCACAGAGTGGCTCAATGG - Intronic
970611750 4:17731367-17731389 AAAGGCACAGACTGGCAAATTGG + Intronic
970679710 4:18492598-18492620 AAAGGCACAGACTGGCAAATTGG + Intergenic
970862483 4:20720281-20720303 AAAGACACAGACTGGCAGATTGG - Intronic
971004026 4:22353778-22353800 AAAGGCACAGAGTGGCAGGTTGG + Intronic
971053737 4:22890104-22890126 AAAGGCACAGACTGGCAAATTGG - Intergenic
971247256 4:24940585-24940607 AAAGGCACAGACTGGCAAATTGG + Intronic
971447790 4:26770151-26770173 AAAGGCAGAGATTGTCAGACTGG + Intergenic
972116874 4:35647100-35647122 TAAGGCAGGGAGTGCCAGATAGG - Intergenic
972261263 4:37410193-37410215 GAAGACACAGACTGGCAAATTGG + Intronic
972455362 4:39248542-39248564 AAAGGCACAGACTGGCAAATTGG + Intronic
972742757 4:41904564-41904586 AAAGACACAGACTGGCAGATTGG - Intergenic
972820844 4:42700240-42700262 AAAGGCACAGACTGGCAAATTGG - Intergenic
972895742 4:43617667-43617689 AAAGGCACAGAGTGGCAAATTGG + Intergenic
973001672 4:44959650-44959672 AAAGGCACAGAGTGTCAATTTGG - Intergenic
973089147 4:46110459-46110481 AAAGGCACAGAGTGGCAGGTTGG - Intronic
973183535 4:47296298-47296320 GAAGACACAGACTGGCAAATTGG + Intronic
973201993 4:47514397-47514419 GAAGCCACAGAGTAGCAGAAAGG + Intronic
973562873 4:52153647-52153669 AAAGGCACAGACTGGCAAATTGG + Intergenic
973584878 4:52379763-52379785 AAAGACACAGAGTGGCAAATTGG + Intergenic
973648361 4:52972206-52972228 AAAGGCACAGACTGGCAAATCGG + Intronic
974164316 4:58181397-58181419 AAAAGCAGAGATTGTCAGATTGG - Intergenic
974493797 4:62601712-62601734 GAAGGCAGAGATTATCAGACTGG - Intergenic
974599485 4:64058787-64058809 AAAGGCACAGAGTGGCACGTTGG - Intergenic
974682225 4:65178640-65178662 AAAGACACAGACTGTCAAATTGG + Intergenic
974723316 4:65770095-65770117 AAAGGCACAGACTGGCAAATTGG - Intergenic
974785637 4:66616960-66616982 AAAGGCACAGGGTGGCACATTGG - Intergenic
974837797 4:67272132-67272154 AAAGACACAGACTGTCATATTGG - Intergenic
975163143 4:71146928-71146950 AAAGGCACAGACTGGCAAATTGG + Intergenic
975178133 4:71310868-71310890 AAAGGCACAGACTGCCAAATTGG + Intronic
975250000 4:72167726-72167748 AAAGACACAGAGTGGCAAATTGG - Intergenic
975255879 4:72234822-72234844 AAAGGCACAGACTGGCAAATTGG - Intergenic
975291383 4:72681448-72681470 TAAGACACAGACTGTCAAATTGG + Intergenic
975424746 4:74213148-74213170 AAAGGCACAGACTGGCAAATTGG - Intronic
975898984 4:79127744-79127766 AAAGGCACAGAGTGGCAAGTTGG - Intergenic
976061112 4:81129783-81129805 AAAGACACAGAGTGGCAAATTGG - Intronic
976222085 4:82764085-82764107 AAAGGCAGAGATTGTCAGATTGG - Intronic
977404611 4:96579853-96579875 AAAGGCACAGACTGGCAAATTGG - Intergenic
977627078 4:99199230-99199252 AAAGGCACAGATTGGCAAATTGG - Intergenic
977653379 4:99494303-99494325 AAAGGCACAGAGTGGCAAATTGG + Intergenic
977763891 4:100775023-100775045 GAAGGCCCAGAGTGGCAAGTTGG - Intronic
977793220 4:101131285-101131307 AAAGGCACAGACTGGCAAATGGG + Intronic
977880198 4:102195976-102195998 GAAGGCACAGTATGTGAGATAGG + Intergenic
977888101 4:102275141-102275163 AAAGGCACAGACTGGCAAATTGG + Intronic
978150504 4:105428389-105428411 AAAGACACAGAGTGGCAAATTGG + Intronic
978710019 4:111768942-111768964 AAAGGCACAGAGTGGCAAGTTGG - Intergenic
978940658 4:114432576-114432598 CAAGGAACAGAGTGGCAAATTGG - Intergenic
979043901 4:115836430-115836452 AAAGGCACAGATTGGCAAATTGG + Intergenic
979201069 4:117978749-117978771 AAAGGCACAGAGTGGCAAGTTGG + Intergenic
979346117 4:119589272-119589294 GTAGGCCCAGAGTGACAAATAGG + Intronic
979698077 4:123637212-123637234 AAAGGCACAGATTGGCAAATTGG - Intergenic
979778057 4:124615887-124615909 AAAGGCACAGACTGGCAAATTGG - Intergenic
979874209 4:125866775-125866797 AAAGGCACAGAGTGGCAAGTTGG + Intergenic
979940838 4:126760308-126760330 AAAGGCAAAGATTGTCAGACTGG + Intergenic
980017268 4:127664787-127664809 GAAGACAGAGACTGCCAGATTGG - Intronic
980317411 4:131220404-131220426 AAAGGCACAGACTGGCAAATTGG - Intergenic
980421980 4:132574188-132574210 AAAGGCACAGAGTGGCAGACTGG + Intergenic
980456363 4:133048516-133048538 AAAGGCACAGAGTGGCAAGTTGG + Intergenic
980576191 4:134686125-134686147 AAAGGCACAGAGTGGCAGGTTGG - Intergenic
980605000 4:135078597-135078619 AAAGGCACAGACTGGCAAATTGG - Intergenic
980792113 4:137633108-137633130 AAAGGCACAGAGTGGCAAATTGG + Intergenic
981109313 4:140917232-140917254 AAAGGCACAGACTGGCAAATTGG + Intronic
981165428 4:141551486-141551508 AAAGACACAGACTGGCAGATTGG + Intergenic
981286989 4:143028868-143028890 AAAGGCACAGAGTGGCAGGCTGG + Intergenic
981345787 4:143674581-143674603 AAAGACACAGACTGGCAGATTGG + Intronic
981361499 4:143850926-143850948 TAAGGTATAAAGTGTCAGATAGG - Intergenic
981372244 4:143971920-143971942 TAAGGTATAAAGTGTCAGATAGG - Intergenic
981381321 4:144075119-144075141 TAAGGTATAAAGTGTCAGATAGG - Intergenic
981645030 4:146989441-146989463 AAAGGCACAGAATGGCAAATTGG - Intergenic
981775295 4:148360301-148360323 GAAAGCACATAGTGTCATGTAGG - Intronic
981833872 4:149031916-149031938 AAAGGCACAGATGGTGAGATGGG - Intergenic
981954236 4:150449987-150450009 AAATGCACAGATTGTCAGACTGG + Intronic
982052278 4:151513492-151513514 GAAGACACAGACTGGCAAATTGG + Intronic
982310657 4:153982031-153982053 AAAGGCACAGACTGACAAATTGG - Intergenic
982378722 4:154724661-154724683 GGTGGCACAGTGTGTCGGATGGG + Intronic
982528454 4:156507767-156507789 AAAGGCACAGACTGGCAAATTGG + Intergenic
982638353 4:157925595-157925617 AAAGACACAGACTGGCAGATTGG - Intergenic
982646365 4:158028540-158028562 AAAGGCACAGAGTGGCAAACTGG + Intergenic
982680841 4:158427404-158427426 AAAGACAGAGACTGTCAGATGGG - Intronic
982852737 4:160340425-160340447 AAAGGCACAGACTGGCAAATTGG - Intergenic
983445000 4:167838991-167839013 AAAGGCAGAGATTGTCAGATTGG - Intergenic
983947872 4:173607010-173607032 GAAGACACAGACTGGCAAATTGG - Intergenic
983964024 4:173788083-173788105 AAAGGCACAGACTGGCAAATTGG + Intergenic
1202753011 4_GL000008v2_random:26513-26535 AAAGGCACAGACTGGCAAATTGG + Intergenic
985676836 5:1236015-1236037 AAAGGCAGAGATTGTCAGATTGG - Intronic
986076471 5:4343007-4343029 GAAGAAACTGAGTGTCAGAAAGG - Intergenic
986149877 5:5118645-5118667 AAAGGCACAGAGTGGCAAACTGG - Intergenic
986442320 5:7793151-7793173 AAAGACACACAGTGTCAGCTGGG + Intronic
986484568 5:8222212-8222234 AAAGGCACAGAGTGGCAAATTGG + Intergenic
986664478 5:10088592-10088614 GAAGACCCCAAGTGTCAGATGGG - Intergenic
986896926 5:12382653-12382675 AAAGGCACAGAGTGGCAAGTTGG - Intergenic
987082583 5:14438885-14438907 GACTGCAGAGCGTGTCAGATGGG - Intronic
987180114 5:15358306-15358328 GAAGACACAGACTGGCAAATTGG + Intergenic
987228977 5:15872471-15872493 AAAGGCACAGACTGGCAAATTGG + Intronic
987279531 5:16398907-16398929 AAAGACACAGAGTGGCAAATCGG - Intergenic
987479280 5:18432532-18432554 AAAGGCACAGACTGGCAAATTGG + Intergenic
987649090 5:20717569-20717591 AAAGACACAGAGTGTCAGGCGGG - Intergenic
987861193 5:23490351-23490373 AAAGGCACAGAGTAGCATATTGG - Intergenic
988032089 5:25775874-25775896 AAAGGCACAGATTTTCAGATTGG + Intergenic
988203981 5:28110536-28110558 GAAGACACAGACTGGCAAATTGG - Intergenic
988238565 5:28577564-28577586 AAAGGCACAGAGTGGCAGGCTGG + Intergenic
988269287 5:28993207-28993229 AAAGACACAGACTGGCAGATTGG + Intergenic
989216546 5:38909917-38909939 AAAGGCACAGAGTGGCAAGTTGG + Intronic
989323911 5:40167584-40167606 AAAAGCACAGAGTGGCACATTGG + Intergenic
989505858 5:42227065-42227087 AAAGGCACAGAGTGACAAGTTGG - Intergenic
989675664 5:43969426-43969448 AAAGGCACAGACTGGCAAATTGG - Intergenic
989684029 5:44063836-44063858 AAAGGCACAGACTGGCAAATTGG - Intergenic
989716157 5:44466245-44466267 AAAGGCACAGAGTGGCAAGTGGG - Intergenic
989733069 5:44670555-44670577 AAAGACACAGACTGTCAAATTGG + Intergenic
989793271 5:45433525-45433547 AAAGGCACAGAGTGCCAAGTTGG - Intronic
989820343 5:45788317-45788339 AAAGGCACAGACTGGCAAATTGG + Intergenic
990071543 5:51789101-51789123 AAAGGCACAGACTGGCAAATTGG - Intergenic
990094966 5:52100754-52100776 AAAGGCACAGACTGGCAAATTGG - Intergenic
990135849 5:52643477-52643499 AAAGGCACAGACTGGCAAATTGG + Intergenic
990142318 5:52719934-52719956 AAAGGCACAGACTGGCAAATTGG + Intergenic
990150616 5:52813498-52813520 GAAGGCAAAGAGGCTCAGATAGG + Intronic
990167919 5:53016037-53016059 AAAGGCACAGAGTGGCAAGTTGG - Intronic
990192061 5:53270179-53270201 GAAGACACAGACTGGCAAATTGG + Intergenic
990239781 5:53804961-53804983 AAAGACACAGACTGGCAGATTGG + Intergenic
990455808 5:55986510-55986532 GAAAGCAGAGATTATCAGATTGG - Intronic
990505749 5:56443035-56443057 GAAAACATAGATTGTCAGATGGG + Intergenic
990657195 5:57970567-57970589 AAAGACACAGACTGTCAAATTGG - Intergenic
990710520 5:58574971-58574993 AAAGGCACAGACTGGCAAATTGG + Intergenic
990897277 5:60713107-60713129 AAAGGCACAGACTGGCAAATCGG - Intergenic
991089078 5:62676752-62676774 AAAGGCACAGACTGGCAAATTGG - Intergenic
991156101 5:63437871-63437893 GTATCAACAGAGTGTCAGATAGG - Intergenic
991383733 5:66061495-66061517 AAAGGCACAGACTGGCAAATTGG - Intronic
991504545 5:67310343-67310365 AAAGGCACAGAGTTGCAGGTTGG + Intergenic
992274468 5:75100875-75100897 AAAGACACAGAGTGGCAAATTGG - Intronic
992292118 5:75290604-75290626 AAAGGCACAGACTGGCAAATTGG - Intergenic
992338290 5:75796579-75796601 AAAGGCACAGACTGGCAAATTGG - Intergenic
992492298 5:77257264-77257286 AAAGGCAGAGATTATCAGATGGG + Intronic
992794331 5:80242167-80242189 AAAGGCAAAGATTGTCAGATTGG + Intronic
992965797 5:81998578-81998600 AAAGGCACAGAGTGGCAAGTTGG + Intronic
993113787 5:83693532-83693554 AAAGGCAGAGATTGTCAGGTTGG + Intronic
993253574 5:85558218-85558240 AAAGACACAGACTGGCAGATTGG + Intergenic
993291784 5:86081566-86081588 AAAGACACAGAGTGGCAAATTGG - Intergenic
993438714 5:87928121-87928143 AAAGGCACAGAGTGGCAAGTGGG + Intergenic
993455524 5:88122420-88122442 AAAGGCACAGACTGGCAAATTGG + Intergenic
993471062 5:88307921-88307943 GAAGACACAGACTGGCAAATTGG + Intergenic
993589796 5:89779963-89779985 AAAGGCACAGACTGGCAAATTGG + Intergenic
993645958 5:90462452-90462474 AAAGGCAGAGATTGTCAGACTGG + Intronic
993685026 5:90927584-90927606 AAAGGCACAGACTGGCAAATTGG - Intronic
993796177 5:92270154-92270176 AAAGGCACAGAGTGTCAAGCTGG + Intergenic
993958690 5:94269466-94269488 GAAGACACAGAGTGGCTGAATGG + Intronic
994437848 5:99761823-99761845 AAAGGCACAGACTGGCAAATTGG - Intergenic
994565830 5:101444222-101444244 AAAGGCACAGACTGGCAAATTGG + Intergenic
994614001 5:102080298-102080320 AAAGGCACAGAGTGGCAACTTGG + Intergenic
995318361 5:110802292-110802314 AAAGGCACAGAGTGGCAAGTTGG - Intergenic
996455652 5:123678512-123678534 AAAGGCACAGACTGGCAAATTGG - Intergenic
996803670 5:127430673-127430695 GAGGGCACAGAGGGCCAGAAGGG + Intronic
997021683 5:130009681-130009703 AAAGGCACAGAGTGGCAAGTTGG + Intronic
997136850 5:131335920-131335942 AAAGGCACAGACTGGCAAATTGG - Intronic
997188327 5:131903828-131903850 AAAGGCACAGAGTGGCAAGTTGG + Intronic
997340024 5:133137063-133137085 AAAGGCACAGACTGGCAAATTGG - Intergenic
997626386 5:135333998-135334020 TAAGTCACAGACTGTCAGAAGGG + Exonic
997744977 5:136291331-136291353 AAAGGCACAGACTGGCAAATTGG + Intronic
998703883 5:144737199-144737221 AAAGGCACAGAGTAGCAAATTGG - Intergenic
998776358 5:145608203-145608225 AAAGGCACAGAGTGGCAAATTGG - Intronic
998972549 5:147609127-147609149 AAAGGCACAGACTGGCAAATTGG - Intronic
999064567 5:148672150-148672172 AAAGGCACAGACTGGCAAATTGG - Intronic
1000011401 5:157236675-157236697 GTAGGAACAGAGTGTTAGATAGG + Intronic
1000271478 5:159688042-159688064 AAAGGCACAGACTGGCAAATTGG - Intergenic
1000402905 5:160851073-160851095 GAAGTAGCAGAGTGCCAGATTGG + Intronic
1000406704 5:160895243-160895265 GAAGACACAGACTGACAAATTGG + Intergenic
1000647863 5:163780588-163780610 AAAGACACAGACTGGCAGATTGG - Intergenic
1000864338 5:166493926-166493948 GGAGGGTCAGAGTGTCAGAGTGG - Intergenic
1001602914 5:172940574-172940596 GAAGTCACAAAGTGCCAGTTGGG + Intronic
1001886491 5:175295302-175295324 GGAGGCACAGAGTGGCAAGTTGG + Intergenic
1001942952 5:175753627-175753649 GAAGAAACAGAGTGTCAGGGAGG - Intergenic
1002009711 5:176268348-176268370 AAAGGCAGAGATTGTCAGACTGG + Intronic
1002216383 5:177637505-177637527 AAAGGCACAGACTGGCAAATTGG - Intergenic
1002217010 5:177643944-177643966 AAAGGCAGAGATTGTCAGACTGG - Intergenic
1002352825 5:178595984-178596006 AAAGGCAAAGATTGTTAGATAGG + Intergenic
1002577668 5:180184608-180184630 AAAGGCAGAGATTTTCAGATTGG + Intronic
1002851046 6:996647-996669 AATGGCCCAGAGTGTCAGAGGGG - Intergenic
1003090871 6:3101909-3101931 GCAGGTACAGAGTTTCAGTTTGG - Intronic
1003295840 6:4827240-4827262 GAAGGCAGAGACTGGCAGAATGG - Intronic
1003320338 6:5045487-5045509 AAAGGTACAGAGTTTCAGTTTGG + Intergenic
1004593442 6:17075629-17075651 AAAGGCACAGACTGGCAAATTGG + Intergenic
1005100731 6:22170317-22170339 AAAGGCACAGACTGGCAAATTGG - Intergenic
1005222560 6:23603823-23603845 AAAGACAGAGAGTGTCAGAGTGG + Intergenic
1005303247 6:24491219-24491241 GAAGGCCCAGAGTGACAGGGAGG - Intronic
1005380529 6:25229699-25229721 GAAACCACAGAGTGACAGATTGG + Intergenic
1005404014 6:25466283-25466305 GTAGAGACAGAGTGTAAGATAGG - Intronic
1005637912 6:27768704-27768726 GAAAGAACAAAGTGACAGATTGG - Intergenic
1005793696 6:29333971-29333993 AAAGGCACAGAGTGGCAAGTTGG + Intergenic
1005800084 6:29411965-29411987 GAAGGCACAGAGTGGCAAGCTGG + Intronic
1006041332 6:31258432-31258454 GAAGACACAGACTGGCAAATTGG - Intergenic
1006590775 6:35154965-35154987 ATAGGCAGAGATTGTCAGATTGG - Intergenic
1006603527 6:35241330-35241352 GAAAGCATAGAGTATCACATTGG + Intronic
1006616815 6:35334147-35334169 AAAGACACAGACTGGCAGATTGG + Intergenic
1007242992 6:40440552-40440574 GAGGCCACAGGGTGTCAGAGGGG - Intronic
1007354155 6:41298531-41298553 AAAGTCACAGAGTGGCAAATTGG + Intergenic
1007882017 6:45178109-45178131 GAAGACACAGACTGGCAAATTGG + Intronic
1008163332 6:48104641-48104663 AAAGGCACAGATTGGCAAATTGG + Intergenic
1008238702 6:49081724-49081746 AAAGACACAGAGTGACAGAATGG - Intergenic
1008350096 6:50479683-50479705 AAAGGCACAGACTGGCAAATTGG + Intergenic
1008424993 6:51347245-51347267 AAAGGCACAGACTGGCAAATTGG - Intergenic
1008936971 6:57001931-57001953 AAAGGCACAGAGTGGCATGTTGG + Intronic
1009015409 6:57893835-57893857 GAAGACACAGAGTGGCAGGCGGG + Intergenic
1009188545 6:60602004-60602026 AAAGGCACAGACTGGCAAATTGG + Intergenic
1009230066 6:61051356-61051378 AAAGACACAGAGTGGCAAATTGG - Intergenic
1009312529 6:62172117-62172139 AAAGGCACAGAACGGCAGATTGG + Intronic
1009599038 6:65773845-65773867 AAAGGCACAGAGTGGCAAGTTGG + Intergenic
1009660121 6:66600727-66600749 TAAGGGACAGAGTGAGAGATGGG + Intergenic
1009695518 6:67097584-67097606 GAAGGCACAGACTGGCAAATTGG + Intergenic
1009849549 6:69178410-69178432 AAAGGCACAGAGTGGCAAGTTGG - Intronic
1009916925 6:70007271-70007293 AAAGGTAAAGAATGTCAGATTGG + Intronic
1010029185 6:71255419-71255441 AAAGACAAAGACTGTCAGATTGG + Intergenic
1010094263 6:72021579-72021601 GAAAGAACACAGTGTCAGTTGGG + Intronic
1010178090 6:73052936-73052958 AAAGGCACAGAGTGGCAAGTTGG + Intronic
1010316824 6:74460978-74461000 AAAGGCACAGAGTGGCAAGTTGG - Intergenic
1010334271 6:74662181-74662203 AAAGGCACAGACTGTCAAATTGG + Intergenic
1010463606 6:76141681-76141703 AAAGGCACAGACTGGCAAATTGG - Intergenic
1010466094 6:76167853-76167875 AAAGGCACAGAGTGGCAAACTGG + Intergenic
1010575144 6:77520615-77520637 AAAGGCACAGACTGGCAAATTGG + Intergenic
1010679792 6:78785183-78785205 AAAGGCACAGACTGGCAAATTGG + Intergenic
1010692166 6:78923113-78923135 AAAGGCACAGACTGGCAAATTGG + Intronic
1010783041 6:79967345-79967367 AAAGGCACAGAGTGGCAATTTGG + Intergenic
1011020467 6:82807436-82807458 AAAGGCACAGACTGGCAAATTGG - Intergenic
1011024166 6:82848041-82848063 GAAGACACAGAGTGGCTGAATGG + Intergenic
1011200433 6:84830379-84830401 AAAGGCACAGACTGGCAAATTGG - Intergenic
1011289440 6:85761261-85761283 GAAGACACAGACTGGCAAATTGG - Intergenic
1011304005 6:85906976-85906998 AAAGGCACAGACTGGCAAATTGG - Intergenic
1011306571 6:85934392-85934414 AAAGGCACAGACTGGCAAATTGG - Intergenic
1011702709 6:89970395-89970417 GAAGGAACAGAATGTCAAAGGGG + Intronic
1011798648 6:90984196-90984218 GATGGCACACAGTGTCACAGAGG - Intergenic
1011926785 6:92655097-92655119 AAAGGCACAGACTGGCAAATTGG - Intergenic
1012050147 6:94331122-94331144 GAAGACACAGACTGTCTGAATGG + Intergenic
1012253472 6:97006460-97006482 AAAGGCACAGAATGTCAACTTGG - Intronic
1012540559 6:100356758-100356780 AAAGACACAGACTGTCAAATTGG + Intergenic
1012608801 6:101190318-101190340 AAAGACACAGACTGTCAAATTGG + Intergenic
1012668881 6:102015387-102015409 AAAGGCACAGAGTGGCAAGTGGG - Intronic
1012691984 6:102325976-102325998 TAAGGCACAGAGTGGCAAGTTGG - Intergenic
1012871105 6:104673260-104673282 AAAGGCACAGACTGGCAAATTGG + Intergenic
1013278798 6:108614660-108614682 AAAGCCAGAGATTGTCAGATTGG - Intronic
1013330657 6:109096471-109096493 TAAGGCCCAGAGTGAGAGATAGG + Intronic
1013642858 6:112104519-112104541 AAAGGCAGAGATTATCAGATTGG + Intergenic
1014040445 6:116818897-116818919 AAAGACACAGACTGGCAGATTGG + Intronic
1014133004 6:117855994-117856016 AAAGGCACAGACTGGCAAATTGG + Intergenic
1014379664 6:120724823-120724845 AAAGGCACAGACTGGCAAATTGG - Intergenic
1014405901 6:121050260-121050282 CAAGGCACAGAGTGTTAAACAGG - Intergenic
1014674397 6:124346786-124346808 AAAGGCACAGACTGGCAAATAGG - Intronic
1014753968 6:125282705-125282727 AAAGGCACAGACTGGCAAATTGG + Intronic
1014907320 6:127045434-127045456 AAAGACACAGAGTGGCAAATTGG + Intergenic
1015131147 6:129810975-129810997 AAAGACACAGAGTGGCAAATTGG - Intergenic
1015175180 6:130298673-130298695 AAAGACACAGAGTGGCACATTGG + Intronic
1015197590 6:130540778-130540800 AAAGGCACAGACTGACAAATTGG + Intergenic
1016005805 6:139088374-139088396 AAAGGCACAGACTGGCAAATTGG - Intergenic
1016018689 6:139212668-139212690 AAAGGCACAGACTGGCAAATTGG + Intergenic
1016942405 6:149493856-149493878 GAAGGCAATGAGTGTCAGGAGGG - Intergenic
1017126992 6:151075199-151075221 AAATGCAAAGAATGTCAGATTGG + Intronic
1018439882 6:163801731-163801753 AAAGGCAGAGATTGTCAAATTGG + Intergenic
1019131201 6:169877302-169877324 CAAGGCACAGAGTGGCTGAATGG - Intergenic
1020548140 7:9560402-9560424 AAAGTCAGAGATTGTCAGATTGG - Intergenic
1020918041 7:14223081-14223103 AAAGGCAGAGATTGTCAGAATGG - Intronic
1021189642 7:17604999-17605021 AAAGGCACAGAGTGGCAAGTTGG + Intergenic
1021202706 7:17743227-17743249 AAAGGCACAGAGTGGCAAGTTGG + Intergenic
1021464454 7:20926308-20926330 AAAGGCACAGACTGGCAAATTGG - Intergenic
1022064147 7:26833411-26833433 AAAGACACAGACTGGCAGATTGG + Intronic
1022961706 7:35432466-35432488 AAAGGCACAGAGTGGCAAGTTGG + Intergenic
1023290373 7:38662077-38662099 AAAGGCACAGAGTGGCAAACTGG + Intergenic
1023305915 7:38826759-38826781 TATGCCATAGAGTGTCAGATGGG - Intronic
1023363430 7:39439310-39439332 AAAGACACAGACTGGCAGATTGG - Intronic
1023661411 7:42474833-42474855 GATGGCAGACAGTGTCAGGTGGG + Intergenic
1024031658 7:45466449-45466471 AAAGACACAGAGTGGCAAATTGG - Intergenic
1024372311 7:48600362-48600384 AAAGGCAGACATTGTCAGATTGG - Intronic
1024380196 7:48687118-48687140 AAAGGCACAGACTGGCAAATTGG + Intergenic
1024396563 7:48875717-48875739 TCAAGCCCAGAGTGTCAGATGGG - Intergenic
1024461211 7:49661550-49661572 GAAGGCAGAGAGTGTGAGAATGG - Intergenic
1024637048 7:51299713-51299735 GAGGACACTGAGTGTCAGAGAGG - Intronic
1024671285 7:51597953-51597975 AAAGGCACAGACTGGCAAATTGG - Intergenic
1024796712 7:53030271-53030293 AAAGGCACAGACTGGCAAATTGG - Intergenic
1025874529 7:65468441-65468463 AAAGGCACAGACTGGCAAATTGG - Intergenic
1026021228 7:66708007-66708029 AAAGGCACAGATTGGCAGAATGG - Intronic
1026885417 7:73939683-73939705 AAAGGCACAGATTGGCAGAATGG - Intergenic
1027733985 7:81909147-81909169 AAAGGCACAGAGTGGCAAGTTGG + Intergenic
1027921907 7:84405084-84405106 AAAGGCACATAGTGGCAAATTGG + Intronic
1028054043 7:86221793-86221815 GAAGGCACAGAGTGACAAGCTGG + Intergenic
1028211492 7:88079536-88079558 AAAGGCACAGACTGGCAAATTGG + Intronic
1028353233 7:89875857-89875879 AAAGGCACAGAGTGGCAAGTTGG - Intergenic
1028355414 7:89900844-89900866 GAAGACACAGACTGGCAAATTGG - Intergenic
1028648479 7:93123527-93123549 GAAGACACAGACTGGCAAATTGG + Intergenic
1028915680 7:96256259-96256281 AAAGGCACAGACTGGCAAATGGG + Intronic
1028929251 7:96394836-96394858 AAAGACACAGAGTGGCAGAATGG - Intergenic
1029369364 7:100138482-100138504 CCAGGTACAGAGTGTCAGAAGGG - Intergenic
1029862194 7:103584255-103584277 GAAGGTACAGACTGGCAGATTGG + Intronic
1030258156 7:107534356-107534378 AAAGGCACAGACTGGCAAATTGG + Intronic
1030392160 7:108941487-108941509 AAAGGCACAGACTGGCAAATTGG - Intergenic
1030457976 7:109797158-109797180 AAAGGCACAGACTGGCAAATTGG + Intergenic
1030644913 7:112049582-112049604 AAAGGCAGAGATTGTCATATTGG + Intronic
1030717496 7:112827223-112827245 AAAGGCAAAGACTGGCAGATTGG - Intronic
1030757474 7:113305731-113305753 AAAGGCAGAAATTGTCAGATTGG - Intergenic
1030997243 7:116373426-116373448 AAAGGCACAGACTGGCAAATTGG + Intronic
1031335255 7:120522078-120522100 GAAGCCACAAAAAGTCAGATTGG - Intronic
1032965789 7:137095449-137095471 AAAGGCACAGAGTGGCAACTTGG + Intergenic
1033209560 7:139450871-139450893 GAAGTCACCCAGTGTCACATGGG - Intergenic
1033392131 7:140938321-140938343 GAAGTCAAAGACTGACAGATTGG + Intergenic
1033525847 7:142212393-142212415 AAAGGCACAGACTGGCAAATTGG + Intronic
1033741159 7:144276839-144276861 GAACACACAGAGGGTCAGAGTGG + Intergenic
1033752746 7:144372775-144372797 GAACACACAGAGGGTCAGAGTGG - Intronic
1033836434 7:145318077-145318099 GTAGATACAGAGTGTGAGATGGG + Intergenic
1033839009 7:145351152-145351174 AAAGGCATAGGGTGTCAGTTGGG - Intergenic
1033856104 7:145562957-145562979 GAAGACACAGACTGGCAAATTGG + Intergenic
1033999601 7:147396240-147396262 GAAGGCTCAGATTCTCTGATTGG - Intronic
1034294918 7:149963643-149963665 GAAGGCACACAGGCTCAGGTGGG + Intergenic
1034322015 7:150194510-150194532 AAAGGCAAAGATGGTCAGATTGG - Intergenic
1034695957 7:153053918-153053940 AAAGGCACAAAGTTTCAGTTAGG - Intergenic
1034770735 7:153772663-153772685 AAAGGCAAAGATGGTCAGATTGG + Intergenic
1034811144 7:154133305-154133327 GAAGGCACACAGGCTCAGGTGGG - Intronic
1035229113 7:157452365-157452387 AAAGGCACAGACTGGCAAATTGG - Intergenic
1035797416 8:2371098-2371120 GAAGCCAGAGGGTGTCAGAGCGG + Intergenic
1035908909 8:3543964-3543986 GAAAGCAGAAAGAGTCAGATAGG + Intronic
1036623126 8:10441105-10441127 AAAGTCAGAGACTGTCAGATTGG - Intergenic
1036673686 8:10811487-10811509 GAAGCCACTGAGTGTCAGGATGG - Intronic
1036745513 8:11406009-11406031 AAAGGCACAGACTGGCAAATTGG - Intronic
1037183537 8:16034677-16034699 AAAGGCACAGACTGGCAAATTGG + Intergenic
1038929166 8:32173530-32173552 AAAGACACAGACTGGCAGATTGG + Intronic
1038936206 8:32255144-32255166 AAAGACACAGACTGGCAGATTGG - Intronic
1039103461 8:33965670-33965692 AAAGGCACAGACTGGCAAATTGG - Intergenic
1039138827 8:34359586-34359608 AAAGGCACAGAGTGGCAAATTGG - Intergenic
1039675436 8:39660293-39660315 GAAGACACAGAGTGGCTGAATGG + Intronic
1039754564 8:40510056-40510078 AAAGGCACAGACTGGCAAATTGG - Intergenic
1039802004 8:40966024-40966046 AAAGGCACAGACTGGCAAATTGG + Intergenic
1039975935 8:42364819-42364841 AATGGCACAGAGTTTCAGTTGGG + Intronic
1040099197 8:43482242-43482264 AAAGGCACAGACTGACAAATTGG + Intergenic
1040556901 8:48487730-48487752 AAAGACACAGAGTGGCAAATTGG + Intergenic
1040606903 8:48943046-48943068 AAAGGCACAGACTGGCAAATTGG - Intergenic
1040686481 8:49879074-49879096 AAAGGCACAGACTGGCAAATTGG - Intergenic
1040811953 8:51463318-51463340 AAAGGCACAGAGTGGCAAGTTGG + Intronic
1040824188 8:51601666-51601688 AAAGGCACAGAGTGGCAAGTTGG - Intronic
1040985137 8:53286024-53286046 GAAGACACAGAATGTCATATTGG - Intergenic
1041017320 8:53603708-53603730 AAAGGCACAGAGTGACAAGTTGG + Intergenic
1041287639 8:56276825-56276847 AAAGGCACAGATTGGCAAATTGG + Intergenic
1041900409 8:62976634-62976656 AAAGGCACAGACTGGCAAATTGG - Intronic
1041907069 8:63045167-63045189 AAAGGCACAGAGTGGCAACTTGG + Intergenic
1042014203 8:64289308-64289330 AAAGGCAGAGAGTCTCAGACTGG - Intergenic
1042073077 8:64957739-64957761 AAAGGCACAGACTGGCAAATTGG + Intergenic
1042115675 8:65428530-65428552 AAAGGCACAGACTGGCAAATTGG + Intergenic
1042362319 8:67896440-67896462 AAAGGCACAGACTGACAAATTGG + Intergenic
1042630176 8:70807453-70807475 AAAGACACAGAGTGGCAAATTGG + Intergenic
1042677967 8:71343555-71343577 GGTGGCACAGAGTGTCACATGGG - Intronic
1042800748 8:72714850-72714872 AAAGGCACAGACTGGCAAATTGG + Intronic
1042956125 8:74252584-74252606 AAAGGCACAGACTGGCAAATTGG + Intronic
1043123654 8:76362169-76362191 AAAGGCACAGACTGGCAAATTGG + Intergenic
1043217114 8:77605887-77605909 AAAGACACAGACTGTCAAATTGG + Intergenic
1043845401 8:85157426-85157448 AAAGGCACAGAGTGGCAACTTGG + Intergenic
1043887900 8:85623514-85623536 GAAGGGACAGAGGATCAGAAGGG - Intergenic
1044162233 8:88934158-88934180 AAAGGCACAGAATGGCAAATTGG - Intergenic
1044283894 8:90388933-90388955 AAAGGCACAGACTGGCAAATTGG + Intergenic
1044303500 8:90611600-90611622 GAAGGTACAGAATGGAAGATGGG + Intergenic
1045053441 8:98347690-98347712 AAAGGCAGAGATTGTCAGAGTGG + Intergenic
1045390816 8:101712450-101712472 AAAGGCACAGACTGGCAAATTGG + Intronic
1045640500 8:104245100-104245122 GAAAGCACATAGAGTGAGATAGG - Intronic
1045705228 8:104914963-104914985 AAAGGCACAGACTGGCAAATTGG - Intronic
1045839572 8:106563161-106563183 AAAGGCACAGACTGGCAAATTGG + Intronic
1046053275 8:109048650-109048672 AAAGGCATAGACTGTCAGACTGG + Intergenic
1046216175 8:111150805-111150827 AAAGGCACAGAGTGGCAAGTTGG - Intergenic
1046255517 8:111692307-111692329 AAAGGCACAGAGTGGCAAGTTGG - Intergenic
1046330958 8:112714112-112714134 AAAGGCACAGACTGGCAGATTGG + Intronic
1046342247 8:112874869-112874891 AAAGACACAGACTGGCAGATTGG - Intronic
1046515078 8:115248793-115248815 GAAAGCACCGAATGTAAGATTGG + Intergenic
1046596802 8:116270956-116270978 AAAGGCACAGAGTGGCAAGTTGG - Intergenic
1046683105 8:117193602-117193624 AAAGGCACAGACTGGCAAATTGG + Intergenic
1046709563 8:117494998-117495020 AAAGGCACAGAGTGGCAAGTTGG - Intergenic
1047147126 8:122215125-122215147 AAAGGCACAGAGTGGCAAGTTGG + Intergenic
1047159378 8:122360310-122360332 AAAGGCACAGAGTGGCAAGTTGG - Intergenic
1047548329 8:125841398-125841420 AAAGACACAGAGTGGCAAATTGG + Intergenic
1047841872 8:128762033-128762055 AAAGGCACAGACTGGCAAATTGG + Intergenic
1047845768 8:128803401-128803423 AAAGGCACAGACTGGCAAATTGG + Intergenic
1048101813 8:131360253-131360275 CAAGGCACAGAGTGGCAAGTTGG - Intergenic
1048553435 8:135454835-135454857 GAAGGGTCAGAGAGTCAGGTGGG + Intergenic
1048659404 8:136579661-136579683 GAAGACTCAGAGTGTGCGATTGG + Intergenic
1048929595 8:139302109-139302131 TAAGACACAGGTTGTCAGATTGG - Intergenic
1049092186 8:140524621-140524643 AAAGGCACAGAGTCTGAGACTGG + Intergenic
1049289132 8:141792257-141792279 GAAGACACTGAGACTCAGATGGG + Intergenic
1050295419 9:4199253-4199275 AAAGGCACAGAGTGGCAAGTTGG + Intronic
1050346150 9:4690074-4690096 GAAGATACATAGTGCCAGATGGG - Intronic
1050392441 9:5159336-5159358 AAAGACACAGAGTGTCAGAATGG + Intronic
1050675301 9:8045566-8045588 AAAGGCACAGACTGGCAAATTGG - Intergenic
1050841620 9:10157081-10157103 AAAGGCACAGAGTGACAAACTGG - Intronic
1051110462 9:13629334-13629356 AAAGGCACAGAGTGGCAAGTTGG + Intergenic
1051116708 9:13703251-13703273 GAAGACAGAGATTGTCAGAGTGG - Intergenic
1051338326 9:16087697-16087719 GAAGACACAGACTGGCAAATTGG - Intergenic
1051495215 9:17714305-17714327 AAAGGCAGAGATTTTCAGATTGG - Intronic
1051574870 9:18603813-18603835 ATAGGCATAGAGTGTCAGTTTGG - Intronic
1051608735 9:18941610-18941632 GAGAGCACAGAGGGGCAGATTGG - Intronic
1051695580 9:19765248-19765270 AAAGGCACAGACTGGCAAATTGG - Intronic
1051790772 9:20799799-20799821 AAAGACACAGAGTGGCAAATTGG - Intronic
1051987455 9:23107268-23107290 AAAGGCACAGACTGGCAAATCGG + Intergenic
1052222552 9:26044891-26044913 AAAGGCACAGACTGGCAAATTGG + Intergenic
1052248975 9:26374771-26374793 AAAGGCAAAGACTCTCAGATTGG + Intergenic
1052378022 9:27740013-27740035 AAAGGCACAGAGTGGCAAGTTGG - Intergenic
1052421063 9:28243481-28243503 GAAGACACAGACTGGCAAATTGG + Intronic
1052449498 9:28610545-28610567 GAAGGAACAGAGGGGCAGAAGGG - Intronic
1052612081 9:30789003-30789025 AAAGACACAGAGTGGCAAATTGG - Intergenic
1052650241 9:31292681-31292703 AAAGGCACAGAGTGGCATGTTGG + Intergenic
1052773719 9:32712431-32712453 AAAGACACAGAGTGGCAAATTGG + Intergenic
1053031063 9:34778317-34778339 AAAGGCAGAAATTGTCAGATTGG + Intergenic
1053568242 9:39275959-39275981 AAAGACACAGAGTGGCAAATTGG + Intronic
1053583121 9:39427472-39427494 AAAGACACAGAGTGGCAAATTGG + Intergenic
1053834216 9:42116713-42116735 AAAGACACAGAGTGGCAAATTGG + Intronic
1054104702 9:60986215-60986237 AAAGACACAGAGTGGCAAATTGG + Intergenic
1054128902 9:61343051-61343073 AAAGACACAGAGTGGCAAATTGG - Intergenic
1054596332 9:67070696-67070718 AAAGACACAGAGTGGCAAATTGG - Intergenic
1054808732 9:69417721-69417743 AAAGGCACAGACTGGCAAATTGG - Intergenic
1054811512 9:69438730-69438752 AAAGGCACAGACTGGCAAATTGG - Intronic
1055180935 9:73386174-73386196 GAAGACACAGAGTGGCTGAATGG - Intergenic
1055231492 9:74072270-74072292 TAAGGCACAGAGTGGCAAGTTGG - Intergenic
1055239457 9:74165823-74165845 AAAGGCACAGACTGGCAAATTGG + Intergenic
1055338765 9:75259931-75259953 GAAGGCACAGACTGGCAAATTGG - Intergenic
1055388122 9:75786752-75786774 AAAGGCACAGAGTGGCAAGTTGG - Intergenic
1055714399 9:79101804-79101826 AAAGGCACAGACTGGCAAATTGG - Intergenic
1055754724 9:79545744-79545766 AAAGGCACAGACTGGCAAATTGG + Intergenic
1056176337 9:84040397-84040419 AAAGGCACAGACTGGCAAATTGG - Intergenic
1056472119 9:86916064-86916086 AAAGCCACAGAGGATCAGATAGG + Intergenic
1056631497 9:88296894-88296916 GAAGACACAGACTGGCAAATTGG - Intergenic
1057120803 9:92572040-92572062 AAAGGCACAGACTGGCAAATTGG - Intronic
1057136911 9:92697479-92697501 AAAGGCACAGAGTGGCAAGTTGG - Intergenic
1057171796 9:92967361-92967383 ACAGGGACAGAGTTTCAGATTGG - Intronic
1057514473 9:95709966-95709988 GAAGACGCAGAGTGGAAGATAGG - Intergenic
1058319335 9:103610231-103610253 GAAGACACAGACTGGCAAATTGG - Intergenic
1058571984 9:106356923-106356945 AAAGGCACAGAGTGGCAAGTTGG - Intergenic
1058591247 9:106567324-106567346 AAAGACACAGACTGTCAAATTGG + Intergenic
1058800128 9:108537683-108537705 GAAGCCTCAGAGTCACAGATGGG + Intergenic
1059594297 9:115700439-115700461 AAAGGCATAGATTTTCAGATTGG + Intergenic
1059773157 9:117446962-117446984 CAAGGCTCAGAATGTGAGATGGG + Intergenic
1060335476 9:122717852-122717874 CAAGGCACAGAGGACCAGATAGG + Intergenic
1060687802 9:125627488-125627510 GAAGGCAGAGAGAGTGGGATGGG + Intronic
1061377160 9:130233362-130233384 GAAGACACAGACTGACAGATGGG + Exonic
1061700386 9:132410797-132410819 GAACCCACAGGGTGACAGATAGG + Intronic
1061934143 9:133847859-133847881 GAAGGGCCACAGTGACAGATGGG + Intronic
1062125785 9:134861530-134861552 GAAGGCACAGGTTGTCAGGATGG + Intergenic
1203365967 Un_KI270442v1:256193-256215 AAAGGCACAGACTGGCAAATTGG + Intergenic
1203409756 Un_KI270583v1:903-925 TAAGGCACAGACTGGCAAATTGG + Intergenic
1203717425 Un_KI270742v1:167015-167037 AAAGGCACAGACTGGCAAATTGG - Intergenic
1203533801 Un_KI270743v1:11218-11240 AAAGGCACAGACTGGCAAATTGG + Intergenic
1203582047 Un_KI270746v1:17129-17151 AGAGGCACAGATTGTCAGACTGG + Intergenic
1203651643 Un_KI270751v1:130604-130626 AAAGGCACAGACTGGCAAATTGG - Intergenic
1185792711 X:2939442-2939464 GATGGCACAGAGAACCAGATTGG + Intronic
1186572599 X:10731267-10731289 AAAGGCAGAGAGTGTCAGACTGG + Intronic
1186914395 X:14204640-14204662 AAAGACACAGATTGGCAGATTGG - Intergenic
1186993145 X:15090588-15090610 AAAGGCACAGACTGGCAAATTGG + Intergenic
1187696886 X:21931562-21931584 GAAGGCACATGGTGTCTGTTTGG + Intergenic
1187700274 X:21958408-21958430 GAAGGCTCAGCGTGTTAGTTTGG + Intronic
1187835342 X:23427246-23427268 AAAGGCACAGACTCTCATATTGG - Intergenic
1188928732 X:36078656-36078678 AAAGACACAGACTGGCAGATTGG - Intronic
1189209305 X:39270143-39270165 AAAGGCACAGAATGTCAAATTGG + Intergenic
1189595106 X:42556154-42556176 AAAGGCACAGACTGGCAAATTGG - Intergenic
1189878345 X:45461370-45461392 AAAGACACAGAGTGGCAAATTGG - Intergenic
1189998035 X:46657412-46657434 GAAGACACAGACTGGCAAATTGG + Intronic
1190214330 X:48469775-48469797 GAAGGGACAGAAAGACAGATGGG + Exonic
1190467217 X:50737399-50737421 AAAGGCATAGACTGTCAGATTGG + Intronic
1190472724 X:50799037-50799059 AAAGGGACAGAGCCTCAGATAGG - Intronic
1190494848 X:51019006-51019028 AAAGGCACAGACTGGCAAATTGG - Intergenic
1190607744 X:52162095-52162117 AAAGGCACAGACTGGCAAATTGG + Intergenic
1190891227 X:54570490-54570512 AAAGGCAGAGACTGTCAAATTGG - Intergenic
1190946943 X:55104281-55104303 AAAGGCACAGAGTGGCTGAATGG + Intronic
1191071818 X:56408981-56409003 AAAGACACAGAGTGGCAAATTGG - Intergenic
1191118015 X:56871163-56871185 AAAGGCACAGACTGGCAAATTGG + Intergenic
1191147196 X:57179312-57179334 AAAGGCACAGAGTGGCACATTGG + Intergenic
1191176973 X:57514836-57514858 AAAGGCACAGAGTGGCAATTTGG - Intergenic
1191207593 X:57850848-57850870 AAAGGCACAGAGTGGCAACTTGG - Intergenic
1191635975 X:63377226-63377248 AAAGACACAGAGTGGCAAATTGG + Intergenic
1191657660 X:63615651-63615673 AAAGGCACAGACTGGCAAATTGG + Intergenic
1191722578 X:64246702-64246724 AAAGGCACAGAGTGACAAGTTGG - Intergenic
1191933173 X:66396102-66396124 GAAGGCAAAGGGTTACAGATTGG + Intergenic
1192029171 X:67490533-67490555 AAAGACACAGACTGTCAAATTGG + Intergenic
1192050767 X:67721996-67722018 GAGGGCACAGAGATTCAGAGAGG + Intronic
1192066186 X:67887907-67887929 GAAGACACAGACTGGCAAATTGG - Intergenic
1192136376 X:68604435-68604457 AAAGGCACAGACTGTCAAATTGG + Intergenic
1192272069 X:69590429-69590451 AAAGGCAGAGATTGTCAAATAGG + Intergenic
1192335277 X:70214351-70214373 AAAGGCACAGACTGGCAAATTGG - Intergenic
1192358581 X:70424823-70424845 GCAGGCCCAGAGTGCCAGAGTGG - Intronic
1192627761 X:72747853-72747875 AAAGGCACAGAGTGGCAGGCTGG + Intergenic
1192653947 X:72972956-72972978 AAAGGCACAGAGTGGCAGGCTGG - Intergenic
1192666887 X:73097886-73097908 AAAGGCACAGACTGACAAATTGG - Intergenic
1192697427 X:73432581-73432603 AAAGGCACAGACTGGCAAATTGG - Intergenic
1192754943 X:74037893-74037915 AAAGGCACAGACTGGCAAATTGG - Intergenic
1192871935 X:75192911-75192933 AAAGGCACAGAGTGGCAAGTTGG - Intergenic
1192876420 X:75233975-75233997 AAAGGCACAGACTGGCAAATTGG + Intergenic
1192882990 X:75307396-75307418 GAAGGCAGAGACTGTCAAATTGG - Intergenic
1192918834 X:75684339-75684361 GAAGACACAGACTGGCAAATTGG - Intergenic
1192948931 X:75996072-75996094 GAAGACACAGACTGGCAAATTGG - Intergenic
1192997831 X:76531228-76531250 AAAGGCACAGACTGGCAAATTGG - Intergenic
1193012216 X:76688791-76688813 GAAGCCAGACACTGTCAGATTGG - Intergenic
1193019740 X:76779034-76779056 AAAGACACAGAGTGGCAAATTGG - Intergenic
1193090068 X:77484282-77484304 AAAGGCACAGAGTCACAAATCGG + Intergenic
1193095166 X:77540007-77540029 AAAGGCACAGACTGGCAAATTGG + Intronic
1193113522 X:77754290-77754312 AAAGGCACAGACTGGCAAATTGG - Intronic
1193156293 X:78177634-78177656 AAAGGCACAGACTGGCAAATTGG + Intergenic
1193180506 X:78449539-78449561 AAAGGCACAGACTGGCAAATTGG - Intergenic
1193270162 X:79519428-79519450 TAAGGCACAGAATGGCAAATTGG + Intergenic
1193406048 X:81103976-81103998 AAAGGCACAGAGTGGTAAATAGG - Intergenic
1193492637 X:82168044-82168066 AAAGGCACAGAGTGGCAAACTGG + Intergenic
1193622943 X:83778919-83778941 AAAGGCACAGACTGGCAAATTGG + Intergenic
1193635640 X:83946182-83946204 AAAGGCACAGAGTGGCAAGTTGG - Intergenic
1193698071 X:84733803-84733825 AAAAGCAGAGATTGTCAGATGGG - Intergenic
1193854440 X:86581413-86581435 AAAGGCACAGAGTGGCAAAGTGG + Intronic
1193874469 X:86844355-86844377 AAAGGCACAGATTGTCAAAGTGG - Intergenic
1193913168 X:87329844-87329866 AAAGGCACAGAGTGGGAAATTGG + Intergenic
1193979735 X:88167592-88167614 AAAGGCACAGAGTGGCAAGTTGG - Intergenic
1194127217 X:90034550-90034572 GAAGACAGAGACTGTCAGAGTGG - Intergenic
1194191171 X:90838391-90838413 AAAGGCACAGACTGGCAAATTGG + Intergenic
1194349295 X:92806647-92806669 AAAGGCACAGAGTGTCAAGTTGG - Intergenic
1194370253 X:93062357-93062379 AAAGGCACAGACTGGCAAATTGG + Intergenic
1194517643 X:94876723-94876745 AAAGGCACAGAGTTGCATATAGG - Intergenic
1194559734 X:95405118-95405140 AAAGGCACAGACTGGCAAATTGG + Intergenic
1194589568 X:95782298-95782320 AAAGGCAGAGATTTTCAGATTGG + Intergenic
1194593734 X:95833758-95833780 GAAGGCACAGAGTGGCAAGCTGG - Intergenic
1194636350 X:96349315-96349337 AAAGACACAGACTGTCAAATTGG - Intergenic
1194985456 X:100485249-100485271 CAAGGCACCGAGTGGCAGCTAGG - Intergenic
1195102538 X:101569025-101569047 AAAGGCACAGACTGGCAAATTGG + Intergenic
1195112377 X:101660274-101660296 TAAGGGGCAGAGTGTCAGAAAGG + Intergenic
1195147682 X:102033616-102033638 AAAGGCACAGACTGGCAAATTGG + Intergenic
1195151441 X:102074130-102074152 AAAGACACAGAGTGGCAGGTTGG + Intergenic
1195170724 X:102265473-102265495 AAAGGCACAGACTGGCAAATTGG + Intergenic
1195188135 X:102421626-102421648 AAAGGCACAGACTGGCAAATTGG - Intronic
1195294043 X:103458499-103458521 AAAGGCACAGACTGGCAAATTGG - Intergenic
1195456613 X:105076995-105077017 AAAGGCACAGACTGGCAAATTGG - Intronic
1195500456 X:105592377-105592399 AAAGGCACAGAGTGGCAAGTTGG - Intronic
1195610488 X:106861674-106861696 AAAGGCACAGAGTGGCAAGTTGG - Intronic
1195689213 X:107610165-107610187 GAAGTGACAGGGTGTCAGAAAGG + Intergenic
1195689842 X:107615541-107615563 GAAGACTCAGAATGTAAGATTGG + Intergenic
1195734993 X:108002989-108003011 AAAGGCACAGAGTGGCAAGTTGG + Intergenic
1195882375 X:109605614-109605636 AAAGGCACAGACTGGCAAATTGG + Intergenic
1195985800 X:110628507-110628529 AAAGGCACAGACTGGCAAATTGG + Intergenic
1196094727 X:111786604-111786626 GAAGACACAGACTGGCAAATTGG + Intronic
1196229990 X:113210478-113210500 GAAGACACAGACTGGCAAATTGG - Intergenic
1196524331 X:116713933-116713955 AAAGGCACAGAGTCTCAAGTTGG + Intergenic
1197042315 X:121952733-121952755 AAAGACACAGATTGTCAGATTGG - Intergenic
1197049341 X:122040655-122040677 AAAGACACAGAGTGACAAATTGG - Intergenic
1197051420 X:122063238-122063260 AAAGGCACAGACTGACAAATTGG + Intergenic
1197122560 X:122908922-122908944 AAAGGCACAGAGTGGCAAGTTGG + Intergenic
1197186640 X:123594449-123594471 AAAGGCAGAGATTGTCAAATTGG + Intergenic
1197361323 X:125506816-125506838 GAAGACAAGGATTGTCAGATGGG + Intergenic
1197811790 X:130451460-130451482 AAAGGCACAGACTGGCAAATTGG - Intergenic
1198067421 X:133112554-133112576 AAAGGCACAGACTGGCAAATTGG + Intergenic
1198168314 X:134079452-134079474 AAAGACACAGAGTGGCAAATTGG + Intergenic
1198188337 X:134277917-134277939 AAAGCCAGAGATTGTCAGATTGG - Intergenic
1198195608 X:134358047-134358069 AAAGGCAGAGAATGTCAGACTGG + Intergenic
1198626931 X:138586557-138586579 AAAGGCACAGAGTGTCAAGTTGG - Intergenic
1198653848 X:138892574-138892596 GGAGGCAGAGTGTTTCAGATGGG + Intronic
1198755376 X:139976807-139976829 AAAGGCACAGATTGTCATATTGG + Intergenic
1198784245 X:140270834-140270856 AAAGGCACAGATTGGCAAATTGG - Intergenic
1198876107 X:141228396-141228418 AAAGACACAGAGTGGCAAATTGG + Intergenic
1199132094 X:144201717-144201739 AAAGGCACAGAGTGACAAATTGG - Intergenic
1199181941 X:144867853-144867875 AAAGGCAGAGATTGTCAGAATGG - Intergenic
1199216750 X:145267781-145267803 AAAGGCACAGAGTGGCAAGTTGG + Intergenic
1199400366 X:147391636-147391658 GAAGGTACAGAGTGGCAAGTTGG + Intergenic
1199520006 X:148724605-148724627 GAAGGCACTGAGTAACAGAGAGG + Intronic
1199559577 X:149148638-149148660 AAAGGCACAGAGTGGCAAGTTGG - Intergenic
1199739658 X:150722667-150722689 GAAGGCAGAGATTGTCAGTTTGG - Intronic
1200657621 Y:5923248-5923270 AAAGGCACAGAGTGTCAAGTTGG - Intergenic
1200737571 Y:6816029-6816051 AAAGGCACAGATTGGCAAATTGG + Intergenic
1200772209 Y:7136780-7136802 GAAGACACAGACTGGCAAATTGG + Intergenic
1201248795 Y:12034557-12034579 GAAGACACAGACTGTCAAATTGG - Intergenic
1201392923 Y:13518248-13518270 GAAGACACAGACTGGCAAATTGG - Intergenic
1201465111 Y:14271818-14271840 AAAGACACAGACTGTCAAATTGG + Intergenic
1201491090 Y:14541994-14542016 AAAGGCACAGACTGGCAAATAGG + Intronic
1201566569 Y:15370881-15370903 AAAGGCACAGACTGGCAAATAGG + Intergenic
1201602429 Y:15746281-15746303 GAAGACACAGACTGGCAAATTGG - Intergenic
1201612032 Y:15853456-15853478 AAAGGCACAGACTGGCAAATTGG + Intergenic
1201745444 Y:17367391-17367413 AAAGGCACAGACTGGCAAATTGG + Intergenic
1202331559 Y:23758449-23758471 AAAGGCACAGACTGGCAAATTGG + Intergenic
1202344184 Y:23904329-23904351 AAAGGCACAGACTGGCAAATTGG - Intergenic
1202526584 Y:25765754-25765776 AAAGGCACAGACTGGCAAATTGG + Intergenic
1202539211 Y:25911611-25911633 AAAGGCACAGACTGGCAAATTGG - Intergenic