ID: 929320378

View in Genome Browser
Species Human (GRCh38)
Location 2:40536900-40536922
Sequence TGTGAGCCTGAAAAACAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 265}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929320376_929320378 3 Left 929320376 2:40536874-40536896 CCATTTGACGCATTTCAATTTCT 0: 1
1: 0
2: 1
3: 8
4: 221
Right 929320378 2:40536900-40536922 TGTGAGCCTGAAAAACAACAGGG 0: 1
1: 0
2: 2
3: 20
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929320378 Original CRISPR TGTGAGCCTGAAAAACAACA GGG Intronic
900011406 1:113064-113086 AGTGAACCTGAAAAATCACAGGG - Intergenic
900027508 1:289630-289652 AGTGAACCTGAAAAATCACAGGG - Intergenic
900041465 1:469072-469094 AGTGAACCTGAAAAATCACAGGG - Intergenic
900062899 1:704049-704071 AGTGAACCTGAAAAATCACAGGG - Intergenic
901227151 1:7620351-7620373 TGTGAGGCTGAGAAACCTCATGG + Intronic
907052694 1:51340379-51340401 TCAGAGCATGAAAAACAGCAGGG + Intronic
907732389 1:57079688-57079710 TGAGAGACTGTAAAACACCAAGG - Intronic
908592717 1:65651209-65651231 TGTGGTCTAGAAAAACAACAAGG + Intergenic
908670606 1:66543535-66543557 TTTGAACGTGAAAAACACCATGG - Intronic
908954998 1:69613942-69613964 TGAAAGCCTGGAAAACAATAAGG + Intronic
909527654 1:76644742-76644764 AGTAAGTCTGAAACACAACAGGG + Intergenic
909911151 1:81259325-81259347 TGTGAGGCAGAAAAACACAAAGG - Intergenic
910850043 1:91641269-91641291 TATGAGCCTGTAAAAAAATATGG - Intergenic
911234092 1:95391261-95391283 TTTGAGGCTGACAAACCACATGG + Intergenic
912995419 1:114528241-114528263 TGTGGCCATAAAAAACAACAAGG - Intergenic
913105219 1:115608087-115608109 TGTGAGCCATAAAAACTTCAGGG + Intergenic
914667707 1:149844936-149844958 GGTGAGACAGAAAGACAACAGGG + Intronic
916537404 1:165716681-165716703 TGTGAGCCTGAAAAGAAAAAAGG + Intergenic
917457449 1:175197244-175197266 TGTGAGCCAGAAACAGAAAATGG - Intergenic
918015248 1:180627245-180627267 CGTGAGCCTGATAAAGAAGATGG - Intergenic
919669782 1:200328173-200328195 TATGAGCCTGGAAAGTAACATGG - Intergenic
921135502 1:212255901-212255923 TGTGTGGCTGAAGAACGACACGG + Intergenic
922259845 1:223929074-223929096 AGTGAACCTGAAAAATCACAGGG - Intergenic
923499460 1:234552224-234552246 TGTGATACTGAAAAAAAAAATGG + Intergenic
924341009 1:243031636-243031658 AGTGAACCTGAAAAATCACAGGG - Intergenic
924451781 1:244185013-244185035 AGTGAGTCTGAAAAACACCCAGG + Intergenic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062809002 10:447967-447989 TGTGATCCTGAATATCAACGGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1062902020 10:1153805-1153827 TGTTTCCTTGAAAAACAACACGG - Intergenic
1064249958 10:13699422-13699444 TGTTAGCCTGTTCAACAACAAGG + Intronic
1066735463 10:38473785-38473807 AGTGAACCTGAAAAATCACAGGG + Intergenic
1070186066 10:74063743-74063765 TGTAAGCCTGAAATACAAGAGGG + Intronic
1071034921 10:81233434-81233456 TGTAAGTCTGAAAAACAGCAGGG - Intergenic
1071961456 10:90811940-90811962 TAAGAGCCTGAAAAACTACTTGG - Intronic
1073636178 10:105201075-105201097 TGAGAGACAGAAAAACAAAAAGG - Intronic
1074045756 10:109837562-109837584 TGTAATCCTGAGAAACCACAAGG + Intergenic
1074507720 10:114086274-114086296 TGTGAGCAGGAAAGACAGCATGG - Intergenic
1075192939 10:120327981-120328003 TGTGAGCCTCATTAATAACAGGG - Intergenic
1075470337 10:122684065-122684087 TGTGATAATGGAAAACAACAAGG + Intergenic
1076102577 10:127794763-127794785 TGTGGGACTGAAAATCCACAAGG - Intergenic
1076275141 10:129192222-129192244 TGTGTGCGTGAAAGACAACTTGG - Intergenic
1076967739 11:105300-105322 AGTGAACCTGAAAAATCACAGGG - Intergenic
1077075685 11:700830-700852 GGTGAGCCTGCAAAGCAACTGGG - Intronic
1077897871 11:6467272-6467294 GGTGAGGGTGAGAAACAACAGGG + Intronic
1078127194 11:8578939-8578961 TGTGAGAATGAAAAACAATCAGG + Intronic
1078654204 11:13223060-13223082 TGGGAGCCTGAAAATTAACCTGG - Intergenic
1078785132 11:14483351-14483373 TGTAAGTTTGAAAAATAACAAGG - Intronic
1078969874 11:16395984-16396006 TATGAGCCTGAGAAAGAAGAGGG - Intronic
1080029223 11:27643364-27643386 TGTGAGTGTGAAGAACAACATGG - Intergenic
1080215261 11:29832589-29832611 TGTAAGACTGAAATCCAACAGGG - Intergenic
1081032085 11:38097495-38097517 TGCAAGCCTGAAATCCAACAGGG + Intergenic
1081108230 11:39099794-39099816 TGCAAGTCTGAAATACAACAGGG + Intergenic
1081712427 11:45225979-45226001 TCTGAGGCTGAAAAACAAATGGG - Intronic
1081977962 11:47247797-47247819 CGTGAACCTGGAAAGCAACAGGG - Intronic
1085383860 11:76144685-76144707 TGTGAGCTTGGAAAACAGCAGGG + Intergenic
1086537823 11:87869402-87869424 TGAGAGCCTGAATAAGAACCCGG + Intergenic
1087546395 11:99589210-99589232 TGTCTGCCTGAATAACAAGATGG + Intronic
1090179733 11:124685785-124685807 TGTAAGTCTGAAATACAACAGGG - Intronic
1091721898 12:2820062-2820084 TGTGGGCATGAAAGACAAGATGG - Intronic
1093781444 12:23141883-23141905 TGTGAGCCTTAGAACCATCATGG - Intergenic
1093902037 12:24646740-24646762 TCTTAGAATGAAAAACAACAAGG + Intergenic
1097072766 12:56367440-56367462 TGAGACTCTTAAAAACAACATGG + Intergenic
1100701600 12:97154509-97154531 TGTGAGACTGAAAAACAAAAGGG - Intergenic
1102002354 12:109565291-109565313 TGTTAGCAAGAAAAATAACATGG - Intronic
1104134349 12:125923283-125923305 TGTGTGTCTGAAAAGCATCAGGG + Intergenic
1106514199 13:30438924-30438946 TGTGTGCCAGAAAAATATCACGG - Intergenic
1106809483 13:33346107-33346129 TGTGTGCCTGACACACAATATGG - Intronic
1107484335 13:40811916-40811938 TGAGAGGCTGACAAACATCAGGG + Intergenic
1108116235 13:47130951-47130973 TGTGCCTTTGAAAAACAACAAGG - Intergenic
1108842260 13:54633663-54633685 TGTTATCCTGAAAAACTTCAAGG - Intergenic
1110013775 13:70373059-70373081 TCTGATCGTGAAAAACCACATGG + Intergenic
1110228338 13:73142996-73143018 AGTGAGACTGAAAAATAGCAGGG - Intergenic
1111117575 13:83800928-83800950 TGTTTGCCTTAAAAACAATAGGG + Intergenic
1111570311 13:90075693-90075715 TTTGATCATGAAAAACAATATGG + Intergenic
1113125113 13:106969423-106969445 TGTGACTCTGTAAAACCACAAGG - Intergenic
1113133025 13:107059673-107059695 TGAAAGCCTGAAATCCAACAGGG + Intergenic
1113331152 13:109329197-109329219 TCTGAGCCTTAAAAGCATCAGGG + Intergenic
1113489280 13:110678791-110678813 AATGAGCTTCAAAAACAACAGGG + Intronic
1113897204 13:113772848-113772870 CGTAATCCTGAAAAAGAACAAGG - Intronic
1115661885 14:35503740-35503762 TGAGAGCCTGCAACACAGCAGGG - Intergenic
1116837332 14:49782526-49782548 TGTGTGCCTGAAAAATAAATAGG - Exonic
1117484458 14:56180625-56180647 TGAGAGTCTGAAAGGCAACATGG - Intronic
1118931427 14:70245229-70245251 TCTAAGCATGAGAAACAACAAGG + Intergenic
1121028157 14:90632052-90632074 TGGCAGCCTGGAAGACAACAGGG - Intronic
1121545885 14:94763246-94763268 TTTGTGTCTGAAAAACATCAAGG + Intergenic
1122246548 14:100407304-100407326 TGTGAGCCTGAGAGTAAACAGGG - Intronic
1122349107 14:101077504-101077526 TCTGGGCCTGAAAAACACCGGGG - Intergenic
1123708458 15:22967737-22967759 TGTGTGACTGAAATACAAGAAGG + Intronic
1124514048 15:30351056-30351078 TGGGAGCCAGAGAACCAACAAGG + Intergenic
1124813673 15:32967023-32967045 TTTGAACCTGAAACATAACACGG - Intronic
1125349802 15:38754787-38754809 TGTGAACTTGATAAACAAGAAGG + Intergenic
1126879900 15:53083214-53083236 AGTGAGCCTGAAAAAGAAAAGGG - Intergenic
1126940795 15:53762973-53762995 TGTGATCCTGGAAAACATGAAGG + Intergenic
1127051561 15:55089386-55089408 TGTGAGCCTGTGAAGCAACTTGG + Intergenic
1128591204 15:68899134-68899156 TGTTAGCCTGAGAGAGAACATGG - Intronic
1128599825 15:68986874-68986896 TGTCAGCCTGAAAACCCTCAGGG - Intronic
1129038731 15:72666225-72666247 AGTGAGCCTGGACAACAACGTGG + Exonic
1129211159 15:74071005-74071027 AGTGAGCCTGGACAACAACGTGG - Exonic
1129399244 15:75270082-75270104 AGTGAGCCTGGACAACAACGTGG + Exonic
1129402851 15:75294358-75294380 AGTGAGCCTGGACAACAACGTGG + Exonic
1129635247 15:77309709-77309731 TGTGAGACTGAAATACTACTTGG - Intronic
1130633760 15:85596922-85596944 TCTGAGGCAGAAAAAAAACATGG + Intronic
1131413991 15:92235914-92235936 TTTGACTCTGAAAAACAAAAGGG - Intergenic
1131419545 15:92293270-92293292 TGTGAACATGAAATACAATAAGG + Intergenic
1131932145 15:97454818-97454840 TGAGAGCTTGAGAAACATCAGGG - Intergenic
1132172881 15:99680725-99680747 TATGAGCATGGAAAACAAAAAGG + Intronic
1133647745 16:7780381-7780403 TGTGAGCATGATAACCATCAAGG + Intergenic
1134813245 16:17185227-17185249 CATCAGCCTGAAAAATAACAGGG + Intronic
1134901841 16:17945175-17945197 GGTGAGGCTGTAAAGCAACATGG + Intergenic
1136637733 16:31536578-31536600 TCTGAGCCTCAAAATCTACAAGG + Intergenic
1137746678 16:50826022-50826044 TGTGAGCCTGCAAAGGATCATGG - Intergenic
1140353614 16:74285928-74285950 TGGGAGCCTGAGAACAAACAGGG + Intergenic
1141022167 16:80507763-80507785 TGTGAGCCTGGAAACCAAAAAGG + Intergenic
1142452941 16:90193839-90193861 AGTGAACCTGAAAAATCACAGGG + Intergenic
1143303701 17:5929567-5929589 TTTGGGCCTGAACAACAAGAGGG + Intronic
1144148014 17:12416715-12416737 TTTCAGCCAGAAAAACATCAAGG - Intergenic
1144483858 17:15648944-15648966 TTTGGGGCTGAAAAGCAACATGG - Intronic
1145071591 17:19814098-19814120 TGTCAGCTTGAAATACAAGATGG - Intronic
1149910747 17:60564728-60564750 TATGAGCCTGTAAGACAACTTGG + Intronic
1152200863 17:78945107-78945129 TGTGCGCTTGAAGAAAAACATGG - Intergenic
1152937662 17:83149921-83149943 AGTGAGCCTGGAAAACCACGAGG - Intergenic
1153044352 18:842201-842223 TGTGATCAGGAAAAACTACAGGG - Intergenic
1157096000 18:44685875-44685897 TTTGAGCCTCAAAAAGCACATGG - Intronic
1158440572 18:57471091-57471113 TGTGAGACTGGAGAACATCATGG - Intronic
1158684993 18:59605477-59605499 AGTGAGCCTGAAAAAGAATGTGG + Intronic
1159921394 18:74230372-74230394 TCTGTGCCTTAAAATCAACATGG + Intergenic
1160644544 19:174923-174945 AGTGAACCTGAAAAATCACAGGG - Intergenic
1163373354 19:16914807-16914829 TGTGAGCCTGAAAGAGGACAGGG + Exonic
1163486619 19:17591384-17591406 TGGGAGTCTGGAAAACAAAAGGG - Intergenic
1166639091 19:44479298-44479320 TGTGATCCTGGAGAACCACAGGG - Exonic
1167845625 19:52161990-52162012 TGTAAGGCTGAAACCCAACAGGG + Intronic
925572006 2:5322459-5322481 TGTGAGCCAGAGATACAAAATGG - Intergenic
925784537 2:7418290-7418312 TGTGAGAGTTAAAAACAAAAAGG - Intergenic
927041770 2:19237502-19237524 TGTCAGCCAGAAAAACATCTGGG - Intergenic
929296565 2:40255161-40255183 TGTTAACATGACAAACAACAAGG + Intronic
929320378 2:40536900-40536922 TGTGAGCCTGAAAAACAACAGGG + Intronic
930097445 2:47576228-47576250 TGTTGGACTGAAAAAAAACATGG + Intergenic
930485215 2:52002779-52002801 TGAGAACCTGAAAGACAAAAGGG + Intergenic
931026066 2:58114702-58114724 TGAGAGCCTGAAAAACTGCTTGG + Intronic
931042943 2:58318128-58318150 TGAGAGCCTGAAAAACTGCTTGG - Intergenic
933892328 2:86783328-86783350 TTTGACCCTGAAAAACACAAAGG - Intergenic
935310074 2:101774987-101775009 TGTGAGATTGATAAACAAAATGG - Intronic
936849293 2:116875775-116875797 TGTTAGCATGAAAATCAAAAAGG + Intergenic
937590781 2:123610920-123610942 TGTGAACCTGTAGAACAAAATGG + Intergenic
939364704 2:141216755-141216777 TGTAAGCTTGAAATCCAACAGGG - Intronic
939568192 2:143809833-143809855 TGTGAGACTGAAAAATAAGCAGG + Intergenic
942788644 2:179732794-179732816 TATGAGATTAAAAAACAACACGG + Intronic
944491115 2:200258885-200258907 TGTTAGCCTGAGAACCAACCAGG + Intergenic
949084384 2:242138502-242138524 AGTGAACCTGAAAAATCACAGGG + Intergenic
1169755335 20:9037390-9037412 TGTGAGCCTTTAAAATCACAGGG + Intergenic
1170546978 20:17442727-17442749 TGGGAGCTTGAAATTCAACATGG + Intronic
1170800048 20:19583348-19583370 TGTGAGCCGCAAAACCAAGATGG + Intronic
1172135319 20:32682780-32682802 TGTGAGTTTGAGAAACGACAAGG - Intergenic
1172174353 20:32963180-32963202 TGTGAAAGTGAAAATCAACAAGG - Intergenic
1172889376 20:38253109-38253131 TGTGAGGCTGAAAAGGAAGAAGG + Intronic
1173399365 20:42710786-42710808 TCTGAGCCTGAAAAAACAGAAGG + Intronic
1174296949 20:49553026-49553048 TGTGAGCTTGAAAAACCATTTGG - Intronic
1174562079 20:51438557-51438579 TGTGAGCCTGGAAGACAGCTGGG - Intronic
1175101255 20:56580314-56580336 TGAGAGCGTCAAAAAGAACAAGG + Intergenic
1175557226 20:59874232-59874254 TGTAAGACTGAAAAACAAAATGG + Intronic
1175793905 20:61759381-61759403 TGTGAGACTGAAACGCCACATGG + Intronic
1176280964 20:64310985-64311007 AGTGAACCTGAAAAATCACAGGG + Intergenic
1178180812 21:30159300-30159322 TGTGAGACTGAAAAGGATCATGG - Intergenic
1178331757 21:31701912-31701934 GGTGAGCCTAAAAAAGAAAAGGG + Exonic
1184385611 22:44172775-44172797 GGTGGGCCTGACAAACAGCATGG - Intronic
949180899 3:1130313-1130335 TGTAACCCTGAAAGATAACACGG + Intronic
951653480 3:24979304-24979326 TGTGAGACAGAAAATTAACAAGG - Intergenic
954082265 3:48219539-48219561 TGTGAGGGTCAAATACAACATGG - Intergenic
954250324 3:49362383-49362405 TCTGAGCCTCTAAAACAACCTGG + Intronic
957249916 3:77759324-77759346 AGTGAGACAGAAAATCAACAAGG + Intergenic
958543514 3:95510520-95510542 TGCAAGCCTGAAACTCAACAGGG - Intergenic
958544758 3:95530534-95530556 TGAGAGACTGAAAAACAACAAGG - Intergenic
959143014 3:102508670-102508692 TGTCATCCTGAAAAACATCTTGG + Intergenic
959367785 3:105484831-105484853 TCTCAGCCAGAAAAACAACTGGG + Intronic
962185564 3:133255685-133255707 TGTGAGTCTCAAAAATAATAAGG + Intronic
963457941 3:145570592-145570614 TGTGAGACAGCAAAACAAGAGGG + Intergenic
964026377 3:152079592-152079614 TGTAAGTCTGAAACCCAACAGGG + Intergenic
964088790 3:152849034-152849056 TGTATGCTGGAAAAACAACATGG + Intergenic
964453257 3:156833111-156833133 TTTGACCCTGAAAAACAAAAAGG + Intronic
967406786 3:189125338-189125360 TTTGATCCTCAAAAACAATACGG - Intronic
967658826 3:192080149-192080171 TGTGAGACTGAAAATAAAAAAGG - Intergenic
968813338 4:2809763-2809785 GGTCAGCCTGAAAAAGAAGAGGG - Intronic
969939480 4:10716500-10716522 TCTAAACCTAAAAAACAACAAGG + Intergenic
970733605 4:19138838-19138860 ACTCAGCCTTAAAAACAACATGG - Intergenic
970929142 4:21488569-21488591 AGTAAGCCTGATAAAGAACATGG + Intronic
971009528 4:22418286-22418308 TGGGAGCCTGAGAATCAAGATGG - Intronic
971213389 4:24641094-24641116 TGAGAGCCTGACCAAAAACAGGG - Intergenic
971822143 4:31571290-31571312 TGAGAGCCAGAAAGAAAACAGGG + Intergenic
971883497 4:32411935-32411957 TATGAGACAGAAAATCAACAAGG + Intergenic
972039559 4:34575311-34575333 TGTCAGCCAGAAAAACAGCGAGG - Intergenic
972265577 4:37455736-37455758 TCTGAGCCGGAAATACAACCTGG + Intronic
973026322 4:45276689-45276711 TATGAGCCTATAAAACAACTTGG - Intergenic
973233910 4:47875287-47875309 GGCCAGCCTGAAAAACAGCATGG + Exonic
974506391 4:62779348-62779370 TGTGACCCTGAAATCCAACCTGG + Intergenic
975206606 4:71650956-71650978 TTTTAGCATGAAAAAAAACAGGG + Intergenic
975390561 4:73812162-73812184 AGTGAGCCAAAAAAAAAACAGGG + Intergenic
975907306 4:79228906-79228928 TGTGAGACTGAAAAATAGAATGG - Intronic
976125045 4:81825033-81825055 TGTGAGTCTGAACAATACCAGGG + Intronic
976351562 4:84065896-84065918 TGTCAGGCTGAAAAAGAAGAAGG + Intergenic
976889278 4:90026076-90026098 TGAGAGTGTGAAAAACACCATGG - Intergenic
977471435 4:97448072-97448094 TGTGAGTCTGAAAGCCAACAGGG - Intronic
977721692 4:100246583-100246605 TTTGATCCTCAAAAACAACCAGG + Intergenic
977862518 4:101981819-101981841 GGTGAACCTGTAAAACAACCTGG - Intronic
979261816 4:118656740-118656762 AGTGAACCTGAAAAATCACAGGG + Intergenic
980141910 4:128928262-128928284 TGTTAGCCTCAAAAACAAATTGG - Intronic
981723625 4:147825578-147825600 TGTGTGCCAGAAAAACCTCATGG - Intronic
981855771 4:149290163-149290185 TCTGAGGAAGAAAAACAACATGG + Intergenic
982499639 4:156137057-156137079 TGAGATCCTTAAAAACAAAAAGG + Intergenic
983150010 4:164266584-164266606 AGTGAACCTGAAAAATCACAGGG - Intronic
986949880 5:13070485-13070507 TGCAAGTCTGAAAAACAGCAGGG + Intergenic
989393209 5:40924234-40924256 TGGAAGTCTGAAACACAACATGG + Intronic
989814608 5:45721095-45721117 TGTGAGCCTGAATTAGAACAGGG - Intergenic
990237009 5:53779320-53779342 TCTGAGTTTGCAAAACAACAAGG + Intergenic
991365131 5:65860190-65860212 TGTGCCCCTGGAAAACAGCAAGG - Intronic
992998526 5:82356666-82356688 TGTGAACCTAAAATACAACAGGG + Intronic
993919544 5:93783788-93783810 GGTGAACCTGAAAACTAACAAGG - Intronic
994344363 5:98667389-98667411 TTTCAGACTGAAAATCAACAAGG + Intergenic
994456157 5:100010734-100010756 TCTGAGCATGACAAACAATAAGG - Intergenic
996342628 5:122455344-122455366 TGTGGGCCTGAAAAATACCTAGG + Intronic
998198435 5:140097126-140097148 TGTGAGCCTGCAATATAAGAAGG + Intergenic
998506899 5:142679418-142679440 AGTGGTCCTGAAAAACCACATGG - Intronic
1001604333 5:172949243-172949265 TTTGTGCCTGAGAAGCAACAGGG + Intronic
1002154940 5:177269818-177269840 TGTTTGCCTGAGAAACAAAAAGG - Intronic
1002732381 5:181349856-181349878 AGTGAACCTGAAAAATCACAGGG + Intergenic
1002752158 6:124248-124270 AGTGAACCTGAAAAATCACAGGG - Intergenic
1003395162 6:5746790-5746812 TTTGAGCCTGGCAAACAGCAAGG - Intronic
1003423312 6:5977695-5977717 TGTGAGTCAGAAGACCAACATGG + Intergenic
1005579307 6:27218332-27218354 TGTGAGCCGGTAAAAAAAAAAGG + Intergenic
1005943371 6:30578012-30578034 TGTGAGGCAGAAATACAGCAGGG + Intronic
1007255803 6:40527569-40527591 TGTCAGCCTGAAATATAAGAAGG + Intronic
1007258608 6:40546093-40546115 TGTGATCCTCAAAAACAGCCAGG - Intronic
1008955049 6:57206420-57206442 TGTTGGCCTTGAAAACAACAAGG + Intronic
1009475650 6:64087932-64087954 TGTGCTCCTGCAAAGCAACACGG - Intronic
1010845610 6:80703017-80703039 TGTGAGCCTGTAAAATCAAAAGG - Intergenic
1013455015 6:110322755-110322777 TTTGAGCCTGAAACACAACCTGG + Exonic
1015088600 6:129327534-129327556 ACTGAGCCTGAAACACAAGACGG + Intronic
1015863899 6:137708244-137708266 TGTGACCTGGAAAAACAGCAAGG + Intergenic
1017857597 6:158364689-158364711 TGTGAGGCTGCAAAACATTAAGG - Intronic
1018556388 6:165055418-165055440 TCTGAGAGTGAAAAACACCAGGG + Intergenic
1019041979 6:169113638-169113660 TGTGAACTTGAAAAACAACTGGG - Intergenic
1019236632 6:170622172-170622194 AGTGAACCTGAAAAATCACAGGG + Intergenic
1021831602 7:24618111-24618133 CCTGAGCCTGAAAAACAGCCTGG - Intronic
1026145843 7:67745783-67745805 TGTAAGCCTGAAGCAAAACAAGG - Intergenic
1027132231 7:75599241-75599263 TGACAGTCTGAAAAACAAGAAGG + Exonic
1027583719 7:80030607-80030629 TGTGAGCCTAAATAGCAAGAAGG + Intergenic
1031318165 7:120283844-120283866 TATAAGCCTGAAAGACAAAATGG + Intronic
1031981240 7:128126902-128126924 TGTGATCCTGAAAGTCGACATGG - Intergenic
1032689141 7:134265387-134265409 TCAGAGCCTGAGTAACAACATGG + Intergenic
1032739441 7:134724132-134724154 TGTGAGCCTGAAGAATCACTGGG + Intergenic
1034854205 7:154525356-154525378 TGAGAGCCTGAAAAATTAGATGG - Intronic
1035511139 8:184436-184458 AGTGAACCTGAAAAATCACAGGG - Intergenic
1035901805 8:3465159-3465181 TCAGAGACTGAAAAACAACAGGG - Intronic
1037315762 8:17597786-17597808 TCTTAGCCTGTAAAACAAGATGG + Intronic
1037791460 8:21946316-21946338 AGTGACCGTCAAAAACAACAAGG + Intronic
1039731034 8:40278296-40278318 TGTGTGCCTGTCTAACAACACGG - Intergenic
1040423687 8:47263192-47263214 TGAGAGCCTGAACAAAAGCAAGG - Intronic
1040799871 8:51328705-51328727 TGTGAGCATGACAAACTACTAGG + Intronic
1041343814 8:56874341-56874363 AGTATGCCTGAAAAACAAGATGG - Intergenic
1042255883 8:66803175-66803197 TGTGTGTATGAAAAACAACAAGG + Intronic
1044148199 8:88743496-88743518 TGAGAGCCTGAAAAACTGCTTGG + Intergenic
1047829222 8:128613194-128613216 TGAGAGCCTGAAAAACTGCTTGG + Intergenic
1049162621 8:141106910-141106932 GGTGAACCTGGAAAACACCATGG - Intergenic
1050519088 9:6478226-6478248 TGACAACCTGAAAAAGAACATGG - Intronic
1051384728 9:16495448-16495470 TGTCAATCTGAAAAATAACATGG + Intronic
1052694072 9:31854046-31854068 TGAGAGCCTGGAAAACAGAAGGG - Intergenic
1052732647 9:32307690-32307712 TTTGATCCTGAACAACAAAATGG + Intergenic
1053882579 9:42611074-42611096 TGCAAGTCTGAAAAACAATAGGG + Intergenic
1053890090 9:42683228-42683250 TGCAAGTCTGAAAAACAATAGGG - Intergenic
1054221606 9:62418542-62418564 TGCAAGTCTGAAAAACAATAGGG + Intergenic
1054229108 9:62490631-62490653 TGCAAGTCTGAAAAACAATAGGG - Intergenic
1056451943 9:86724812-86724834 TGTGAGCCTGGAACACAAAAAGG + Intergenic
1056817770 9:89813959-89813981 TGGGGGCCTGAAAAAAAAAAAGG + Intergenic
1058240265 9:102548746-102548768 TGTAAGCCTGAAATCCAATAGGG - Intergenic
1059765761 9:117382411-117382433 TGTGAGCATAAAAAGAAACATGG - Intronic
1062756783 9:138302183-138302205 AGTGAACCTGAAAAATCACAGGG + Intergenic
1187733079 X:22276559-22276581 TTTAAGTCTGAAAAACAATATGG + Intergenic
1188622310 X:32240980-32241002 TGGGATCCTGAAAAACAAATTGG + Intronic
1190038495 X:47049465-47049487 TGAGACCCTGAAAAAAAAAAAGG - Intronic
1193856869 X:86613015-86613037 ATTTAGCCAGAAAAACAACATGG - Intronic
1194505528 X:94729515-94729537 TGTGAGCCTGTAAAAACAAAAGG + Intergenic
1197366685 X:125572488-125572510 TATGAGCCTGTAAAATAAAAAGG + Intergenic
1197980028 X:132208144-132208166 TGTCAGCCTGAAGAAAAAAAGGG + Intronic
1198279671 X:135129292-135129314 TGTGAGGCTGAAACAGAAAAAGG + Intergenic
1198291286 X:135243222-135243244 TGTGAGGCTGAAACAGAAAAAGG - Intergenic
1198319854 X:135510081-135510103 TGTCAGCCAGAACATCAACATGG + Intergenic
1199792046 X:151164397-151164419 TGGGAGGCTGAAAAAAATCAGGG + Intergenic
1200304474 X:155009922-155009944 TGTGAGACAGAAAAACAAAAAGG + Intronic