ID: 929320486

View in Genome Browser
Species Human (GRCh38)
Location 2:40538192-40538214
Sequence CTAGCCCTGCCTATCTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 228}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929320486_929320491 27 Left 929320486 2:40538192-40538214 CCCTGTGAGATAGGCAGGGCTAG 0: 1
1: 0
2: 3
3: 29
4: 228
Right 929320491 2:40538242-40538264 GAGGAGATTAAGGATCAAAAAGG 0: 1
1: 0
2: 3
3: 46
4: 488
929320486_929320488 8 Left 929320486 2:40538192-40538214 CCCTGTGAGATAGGCAGGGCTAG 0: 1
1: 0
2: 3
3: 29
4: 228
Right 929320488 2:40538223-40538245 TACTAGTCTCCATGTGTATGAGG 0: 1
1: 0
2: 0
3: 9
4: 96
929320486_929320490 17 Left 929320486 2:40538192-40538214 CCCTGTGAGATAGGCAGGGCTAG 0: 1
1: 0
2: 3
3: 29
4: 228
Right 929320490 2:40538232-40538254 CCATGTGTATGAGGAGATTAAGG 0: 1
1: 0
2: 0
3: 10
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929320486 Original CRISPR CTAGCCCTGCCTATCTCACA GGG (reversed) Intronic