ID: 929320486

View in Genome Browser
Species Human (GRCh38)
Location 2:40538192-40538214
Sequence CTAGCCCTGCCTATCTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 228}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929320486_929320491 27 Left 929320486 2:40538192-40538214 CCCTGTGAGATAGGCAGGGCTAG 0: 1
1: 0
2: 3
3: 29
4: 228
Right 929320491 2:40538242-40538264 GAGGAGATTAAGGATCAAAAAGG 0: 1
1: 0
2: 3
3: 46
4: 488
929320486_929320488 8 Left 929320486 2:40538192-40538214 CCCTGTGAGATAGGCAGGGCTAG 0: 1
1: 0
2: 3
3: 29
4: 228
Right 929320488 2:40538223-40538245 TACTAGTCTCCATGTGTATGAGG 0: 1
1: 0
2: 0
3: 9
4: 96
929320486_929320490 17 Left 929320486 2:40538192-40538214 CCCTGTGAGATAGGCAGGGCTAG 0: 1
1: 0
2: 3
3: 29
4: 228
Right 929320490 2:40538232-40538254 CCATGTGTATGAGGAGATTAAGG 0: 1
1: 0
2: 0
3: 10
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929320486 Original CRISPR CTAGCCCTGCCTATCTCACA GGG (reversed) Intronic
900121874 1:1051707-1051729 CCTCACCTGCCTATCTCACAGGG + Exonic
900537286 1:3185161-3185183 CTCGCCCTGCCCATCTCCCTTGG + Intronic
900541333 1:3204518-3204540 CTAGCCCTGCCCCTGTCCCAGGG + Intronic
902238854 1:15074986-15075008 CCTGTCCTGCCTACCTCACAGGG - Intronic
903441782 1:23393811-23393833 CTAGCCCTGCCTAGTGCAGAGGG - Intronic
903473867 1:23606148-23606170 CTAGCAGTTCCTAGCTCACAGGG + Intronic
904670493 1:32161261-32161283 CTAGTCCTGCCTCTCTCCCCTGG - Intronic
907069103 1:51518656-51518678 CCAGACCTGCCTTTCTCCCAGGG - Intronic
907596470 1:55724924-55724946 CTATGCCTGCCTAACTTACAGGG + Intergenic
907598356 1:55741870-55741892 GAAGCCCTGCCTATCTGTCAGGG - Intergenic
907608553 1:55844234-55844256 CTAGAACTGCCCATCCCACATGG - Intergenic
907896938 1:58700936-58700958 TTAGCTCTGCCTACCTCACTGGG - Intergenic
908253222 1:62281721-62281743 CCATCCCTGCCTTTCTCCCAGGG + Intronic
909246649 1:73294002-73294024 CTAGCCTTGACTGTCTCACTTGG - Intergenic
910227826 1:84954511-84954533 CTAATAGTGCCTATCTCACAAGG - Intronic
911447025 1:98009138-98009160 CTAGCTCTTGCTATCTCAGAGGG + Intergenic
913014101 1:114715476-114715498 CTTGTCCTGCCTACCACACAGGG - Intronic
913534194 1:119755596-119755618 CTACCTCTGGCTACCTCACAGGG - Exonic
913563963 1:120052484-120052506 ATATTCCTGCCTATTTCACATGG + Intronic
913634162 1:120741081-120741103 ATATTCCTGCCTATTTCACATGG - Intergenic
914620980 1:149408095-149408117 ATATTCCTGCCTATTTCACATGG - Intergenic
914916329 1:151821536-151821558 CTAGCAGGGCCTATTTCACAGGG - Intronic
915286888 1:154858906-154858928 CTTTCCCTGCCTTCCTCACAGGG + Intronic
916784718 1:168078174-168078196 TTTGCCCTACCTATGTCACAGGG + Intergenic
917328516 1:173858329-173858351 CTTGCCCTGGCTACCTCACCGGG + Exonic
917347201 1:174040526-174040548 CTAACTGTGCCTACCTCACAAGG - Intergenic
917937865 1:179886474-179886496 TTTGCCCTGCATAACTCACAGGG + Intronic
918142272 1:181729604-181729626 CCTGCCCTTCCTATCCCACAAGG + Intronic
921221162 1:212974926-212974948 CTCTCCTTGCCTATCTGACACGG + Intronic
922484511 1:225962807-225962829 CTAACCCTTCCTCTCTTACAGGG - Intergenic
924024539 1:239818550-239818572 GTAGCCCTGCTTCTCACACAGGG + Intronic
924065318 1:240215340-240215362 CTAACGGTGCCTGTCTCACAGGG - Intronic
1064278736 10:13931588-13931610 CTATCCCTGCACATCTCACGTGG + Intronic
1064381345 10:14844223-14844245 CCTGCCCTGCCTACCTCACAGGG + Intronic
1070201863 10:74214886-74214908 ATAAACCTGCCTATGTCACAGGG - Intronic
1070233224 10:74594827-74594849 CATGCCCTACCTATCTCTCAAGG - Intronic
1070664949 10:78336291-78336313 CCATCCCTGCCTACCTCCCAGGG - Intergenic
1070831291 10:79419564-79419586 CTTGGCCTGCCCCTCTCACATGG - Intronic
1071146413 10:82578770-82578792 CTAATCATACCTATCTCACAGGG - Intronic
1074206349 10:111286327-111286349 ATTCCCCTGCCTCTCTCACATGG - Intergenic
1075566819 10:123511059-123511081 CTGGCCCTGCCCTTCTCACCAGG - Intergenic
1076776938 10:132703097-132703119 CTGGTCCTGACTGTCTCACAAGG + Intronic
1077795343 11:5485716-5485738 CTAGCCATGCAGATCTCAGAAGG - Intronic
1078270825 11:9793213-9793235 ACAGCCCTGCCTATCACACAGGG - Intronic
1078544340 11:12235850-12235872 CCTGCCCTGCCTATGTCACCGGG + Intronic
1078694982 11:13622141-13622163 CTTGCCTTGCCTACCTCACTGGG - Intergenic
1079201941 11:18384008-18384030 GTAACCCTGCCTAGCCCACAGGG - Intergenic
1079290898 11:19186980-19187002 CCAGCCCTGCCTACCTTATAGGG - Intronic
1079470071 11:20769679-20769701 CAAGCCCTGCGCATCTCTCAAGG - Intronic
1082034033 11:47629684-47629706 GCTGTCCTGCCTATCTCACAGGG + Intronic
1083453688 11:62763618-62763640 CTTGCCCTGCCTAACTCAGAGGG + Intronic
1083794589 11:65007856-65007878 CTGGCCTTGCCAATCTCACCTGG + Intergenic
1085637730 11:78171308-78171330 ATAACCCTACCTACCTCACAGGG - Exonic
1088882906 11:113985820-113985842 CTCACCATACCTATCTCACAGGG - Intronic
1092157627 12:6294646-6294668 CTTGCCCTGGCTTCCTCACAGGG + Intergenic
1095828139 12:46552046-46552068 CTAACACTACCTATCTCAGAGGG + Intergenic
1096598230 12:52710995-52711017 ATAACACTGCCTACCTCACAGGG + Intergenic
1097055870 12:56248810-56248832 GTAGCCCTGCCTGTCCCGCAGGG + Exonic
1097517926 12:60629020-60629042 GTAGCTCTGCTTATCTAACAGGG - Intergenic
1100103062 12:91133445-91133467 CTATCCCTGACTATCACAAAAGG + Intergenic
1100327211 12:93550961-93550983 CTCACCCTTCCCATCTCACATGG + Intergenic
1102315988 12:111888070-111888092 AGAGCCCTGACCATCTCACATGG - Intronic
1102552386 12:113701093-113701115 CTAGGCATGCCTCCCTCACAGGG - Intergenic
1102798234 12:115708170-115708192 GAAGCCCTGGCTCTCTCACAGGG + Intergenic
1103225258 12:119282012-119282034 CTAACAATACCTATCTCACAGGG - Intergenic
1103813572 12:123635060-123635082 CCAGGCCTGCCTCCCTCACAGGG - Intronic
1104503232 12:129305743-129305765 ATAGCACTGCGTCTCTCACAGGG + Intronic
1106323160 13:28660939-28660961 CCAGCCCAGCCTATCACACATGG - Intronic
1108705071 13:52977927-52977949 GTAGCACTGCCTGTCTCAGAGGG + Intergenic
1108813123 13:54254478-54254500 CTAGCCTAGCCTATGTGACATGG + Intergenic
1109419485 13:62092501-62092523 ATAGCAGTACCTATCTCACAGGG - Intergenic
1116976018 14:51116865-51116887 CTAGCCCTTCCTGACTCAGAAGG - Intergenic
1118498175 14:66329571-66329593 TTTGTCCTGCCTATATCACAAGG - Intergenic
1118540437 14:66817767-66817789 CTAGCCCAGCCTTCCTGACATGG + Intronic
1121820951 14:96965650-96965672 CTCAGCCTGCCTATCTAACAGGG + Intergenic
1122546878 14:102527954-102527976 CAAGCCCTCCCCATCCCACAGGG - Intergenic
1124019702 15:25909295-25909317 CAAGCCCTGCTTTTGTCACATGG + Intergenic
1127327142 15:57906746-57906768 CTTGCCCTGCCTGTCTCTTAGGG - Intergenic
1129672083 15:77613097-77613119 CCTGCCCTGCCTACCTCACAGGG - Exonic
1130106611 15:80933211-80933233 CTAGCCCTGCCTAACTTTCCTGG + Intronic
1130893131 15:88150214-88150236 GCAGCCCTGCCCATCTCAGAGGG + Intronic
1130911147 15:88271624-88271646 TTCTCCCTGCTTATCTCACATGG - Intergenic
1131105906 15:89734421-89734443 CTAGTACAGCCTTTCTCACATGG + Intronic
1132766480 16:1536953-1536975 CCAGGCCTGCCTAGGTCACACGG - Intronic
1132792360 16:1698840-1698862 CTGGCGCTGCCTTTCTCACCTGG - Exonic
1136628482 16:31476207-31476229 CGAGCCCGCCCTATCTCACCAGG + Intronic
1137675957 16:50304024-50304046 CAAGCCCTGCCTCTCTCCCTGGG + Intronic
1137882989 16:52071934-52071956 TAAGACCTCCCTATCTCACAGGG + Intronic
1139001788 16:62519663-62519685 CTAAGCCTGCTTACCTCACATGG - Intergenic
1139499095 16:67346123-67346145 CCAGCCCTGCCTTTCTCACGGGG + Intronic
1141078429 16:81030133-81030155 CTGGCCCTGCCCTTGTCACATGG + Intronic
1141684789 16:85563996-85564018 CAAGCCCTGCCCAGCTCACAGGG - Intergenic
1141753998 16:85979200-85979222 CCAGCCCTCCCTAACTCACCCGG + Intergenic
1141955818 16:87370644-87370666 CTGCCTCTGCCTGTCTCACAGGG - Intronic
1147003696 17:37384510-37384532 CTTGCTCTACCTATTTCACAGGG - Intronic
1147010418 17:37442045-37442067 CTTGCTCTGCCTATCTCACTGGG - Intronic
1148220831 17:45860638-45860660 CTCCCCCTGCCTTTCTCTCATGG + Intergenic
1148952170 17:51322881-51322903 CCTGCCCTGCCTATCTCCCAAGG - Intergenic
1152254818 17:79232140-79232162 CTGGCCCTGCCTTTGACACATGG + Intronic
1153587867 18:6642264-6642286 CAAACCCTGGCTATCTCACGTGG + Intergenic
1156460096 18:37316780-37316802 CTAGCCCTGCCTCCCTCACCTGG + Intronic
1157165411 18:45354340-45354362 CCAGCTCTGCCTATTTCTCAAGG - Intronic
1157552569 18:48591629-48591651 CTGGCCCTGCCTACCTGCCAGGG - Intronic
1161868728 19:6854095-6854117 CCAGCCCTGCCTGCCTCACCCGG - Exonic
1162061126 19:8096179-8096201 CTAGCCCTGCCTAGATGACTGGG + Intronic
1163717367 19:18879977-18879999 CTGGCCCAACCTATCTCACCAGG + Intronic
1164802295 19:31087681-31087703 CTAGCACTGCACATCTCACATGG + Intergenic
1164860666 19:31559850-31559872 CTGGTCCTGCCTTTCTCACTCGG + Intergenic
1166075510 19:40411726-40411748 CCAGCTCTGCCTATCCCACTAGG + Intronic
1166335241 19:42102104-42102126 CAAGTCCTGCCTATTTCAAATGG - Intronic
1167419240 19:49393550-49393572 CTGGCCCAGCCTCTCTCCCAGGG - Intronic
925704421 2:6670236-6670258 CCGGCCCTGCCTATAGCACATGG - Intergenic
925890669 2:8431541-8431563 CTTGCTCTGCCTCTCTCATAAGG - Intergenic
927000999 2:18794062-18794084 TCAGCCCTTCCTATCTTACATGG - Intergenic
927173314 2:20388401-20388423 GCTGCCCTGCCTACCTCACAAGG + Intergenic
927786324 2:25977707-25977729 CCAGTCCTGCCTATTTCCCAGGG - Intronic
928092268 2:28382219-28382241 CTTTCTCTGCCCATCTCACAGGG - Intergenic
928122532 2:28593446-28593468 CACGCCCTGCTCATCTCACAGGG - Intronic
928294065 2:30067422-30067444 CCTGCCCTGCCTATTTCATATGG + Intergenic
929320486 2:40538192-40538214 CTAGCCCTGCCTATCTCACAGGG - Intronic
931660310 2:64555358-64555380 CTAGCCCTGCCTGGCCAACATGG + Intronic
931672393 2:64659235-64659257 CCTGCCCTGCCTATGGCACAGGG - Intronic
932092420 2:68818130-68818152 CCTGCCCTGCCTACCTCACAAGG - Intronic
933100584 2:78251710-78251732 CCAGTGCTGCCTATCTCAAATGG + Intergenic
934313089 2:91888077-91888099 CAAGACCTGCCTAGCTAACATGG - Intergenic
935329015 2:101962737-101962759 CTTGCCCTGCATTCCTCACAGGG + Intergenic
937979859 2:127608632-127608654 CCAGCCCTGCCTACCCCACAGGG - Intronic
943098887 2:183462722-183462744 CTAGTCCTACTTTTCTCACAAGG + Intergenic
943816546 2:192264362-192264384 CTCACTCTTCCTATCTCACATGG + Intergenic
944088112 2:195872687-195872709 CTGGCCCTGCTCATTTCACAGGG - Intronic
944237391 2:197452996-197453018 CCTGCCTTGCCTATCTCACGGGG - Intergenic
944490951 2:200257411-200257433 CTTGCTCTGCCCATCCCACAGGG + Intergenic
945746641 2:213726251-213726273 CTAGCATTGGCTATCTCTCAGGG + Intronic
946802806 2:223438361-223438383 CTAGACCTGCCTGTCCAACATGG + Intergenic
947099383 2:226603479-226603501 CTTGTCCTGTCTGTCTCACAGGG - Intergenic
947548478 2:231029324-231029346 TTAGCCCTTCCTTTCCCACAGGG + Intergenic
1169649847 20:7854829-7854851 CTAGCCCAGGCTTTCGCACATGG + Intergenic
1170544940 20:17427845-17427867 CTAGCCCGGGCTTACTCACATGG + Intronic
1171524174 20:25796627-25796649 CGAGCCCATCCTATCTCACTCGG - Intronic
1171533309 20:25866143-25866165 CGAGCCCATCCTATCTCACTCGG - Intronic
1171552653 20:26059256-26059278 CGAGCCCATCCTATCTCACTCGG + Intergenic
1172824669 20:37771112-37771134 CCTGCCCTTCCAATCTCACAGGG + Intronic
1173478388 20:43379818-43379840 CTAGCCCAGGCTTTCTTACATGG + Intergenic
1174025555 20:47571203-47571225 CTAGACCTGCCTAGCCAACATGG - Intronic
1174595176 20:51678218-51678240 CCAGCCCTGCCAAGCTCTCAGGG + Intronic
1175230929 20:57472671-57472693 CTAGCCCTGCCCTTGACACATGG - Intergenic
1175350603 20:58315384-58315406 CCAGTCCTGCATACCTCACACGG + Intronic
1175350638 20:58315570-58315592 ATAGCCCTGCCTACCTTATAGGG + Intronic
1177330539 21:19654920-19654942 CAAGACCTGCCTATCCAACATGG + Intergenic
1177346750 21:19883077-19883099 CTAGTCCTTCCTATTTCACAAGG - Intergenic
1177360650 21:20064756-20064778 CTAGCCCAGCCTGCCTCACATGG + Intergenic
1181492524 22:23269395-23269417 CTAACCCTGCGGTTCTCACACGG - Intronic
1181846490 22:25713554-25713576 CTACCCCTGCTTATCTTTCAAGG + Intronic
1181867245 22:25868523-25868545 TCTGCCCTGCCTATCTTACAAGG + Intronic
1183357524 22:37367590-37367612 ATGGCCCTGCCTCTCTGACAGGG + Intergenic
1184272307 22:43391704-43391726 CTAGCCATGGCTTTCTCCCAAGG - Intergenic
949757092 3:7424485-7424507 CTTACCCTGACTATCTCACAAGG - Intronic
950090973 3:10294220-10294242 CAAGCTCTGCCTCTCTCACTGGG + Intronic
951725795 3:25757400-25757422 CCTACCCTGCCTACCTCACAGGG + Intronic
952145244 3:30525349-30525371 CTAGCCAGCCCTAACTCACAAGG - Intergenic
953207986 3:40848962-40848984 TTTGCCTTGCCTGTCTCACAGGG + Intergenic
954679097 3:52331958-52331980 CCTGCCCGGCCCATCTCACAAGG - Intronic
955621161 3:60865706-60865728 ATAAGCATGCCTATCTCACAGGG - Intronic
960050146 3:113231803-113231825 CTTTTCCTGCCTATCTCACAAGG - Intronic
961040746 3:123676313-123676335 ATAGCCCAGCCTCTCTCCCAGGG + Intronic
962290993 3:134136233-134136255 CTTGCACTGCTTATCTCACAGGG + Intronic
962448186 3:135487486-135487508 CTAGCCCAGGCTTTTTCACATGG + Intergenic
962713438 3:138106967-138106989 CCAGCCCTGCCTACCTCACAGGG + Intronic
964450240 3:156805386-156805408 CTAGAGCTGCCTCTCTAACAGGG - Intergenic
967500676 3:190193836-190193858 CTGGTCCTGCATAGCTCACATGG - Intergenic
968978163 4:3832732-3832754 CCAACCCTGCCTATCTCTCACGG - Intergenic
970180174 4:13383860-13383882 GCAGTCCTGCCTATCACACAGGG + Intronic
972787943 4:42345104-42345126 CTTCCCCTGCCTGTGTCACAGGG - Intergenic
974209679 4:58753749-58753771 CTGCACCTGCCTATCTCACCTGG - Intergenic
979434527 4:120673208-120673230 CCAGCCTTGATTATCTCACAGGG + Intergenic
980425927 4:132628070-132628092 CTAGTCCTGCCTTTGACACATGG - Intergenic
982602572 4:157470246-157470268 CTAGACCTCCCTGTTTCACATGG + Intergenic
983872843 4:172842013-172842035 CAAGCCTGGCCTAACTCACAGGG - Intronic
989080960 5:37620766-37620788 TTAGCCTTGCCTATCTCACAAGG - Intronic
989425984 5:41296311-41296333 CTATCACTGTCTAACTCACAGGG - Intergenic
991309109 5:65215257-65215279 CTGCCCCTTCCTACCTCACAAGG + Intronic
993992445 5:94676366-94676388 CTAGTCCTGCCGATCACACCAGG + Intronic
994584351 5:101686163-101686185 ATAGCACTGCTTATATCACACGG - Intergenic
997941090 5:138158166-138158188 CTTGTCCAGCCTACCTCACAGGG - Intronic
999404180 5:151292512-151292534 CCCACCCTGCCTACCTCACAAGG + Intronic
1000184108 5:158842245-158842267 GTAGCCCTGCTGATCACACATGG + Intronic
1001481441 5:172091854-172091876 CCAGCCCTGCCTTCCTAACACGG + Intronic
1005117200 6:22351958-22351980 CTTGCCCTGCCATTCTCAGAAGG + Intergenic
1006475489 6:34249935-34249957 CTTGCCCTGCCTAGCTCACAAGG - Intergenic
1007607232 6:43125766-43125788 CTTCCTCTGCCTCTCTCACAAGG - Intronic
1007618240 6:43195227-43195249 CTAGCCCAGTCCATCTCTCATGG + Intronic
1011786350 6:90849802-90849824 CTATACATGCCTCTCTCACACGG + Intergenic
1014255444 6:119156531-119156553 CTGGACCTGCCAATCTCTCAGGG - Intergenic
1014885469 6:126775471-126775493 CTAGCAATTCCTATATCACATGG - Intergenic
1015006017 6:128282733-128282755 CCAGCCCTATCTATCTCATAGGG + Intronic
1015675524 6:135743053-135743075 CCAACCCTGCTTATATCACACGG - Intergenic
1018504607 6:164451244-164451266 TCTGCCCTGCCTATCTCAAAGGG - Intergenic
1018508596 6:164499588-164499610 ATGGCCATGCCCATCTCACATGG - Intergenic
1018854311 6:167664505-167664527 CTAGCCCTGCCTTTCAGACACGG + Intergenic
1019872420 7:3777409-3777431 CCGGCCCTGACGATCTCACAAGG - Intronic
1020396164 7:7721029-7721051 CGATCTCTGCCTCTCTCACATGG - Intronic
1021202614 7:17742588-17742610 ATAGTCCTGCCTATCTAGCATGG + Intergenic
1022445849 7:30470005-30470027 CTATCCCCGCCTCTCTCAGAGGG + Intronic
1022887059 7:34657522-34657544 CCTTCCCTGCCTATCTCACAAGG + Intergenic
1023119362 7:36893805-36893827 TAAGGCCTGCCCATCTCACAGGG + Intronic
1023850501 7:44147459-44147481 CTAACCCTTCATCTCTCACAGGG + Intronic
1025104261 7:56157907-56157929 CTACCCCTGCCTACCTCAGGAGG + Intergenic
1026316520 7:69232332-69232354 CTACCCCTGCCTATCCCAGGAGG - Intergenic
1026541823 7:71286478-71286500 CTGGCCCTGTCTGGCTCACAGGG - Intronic
1028295625 7:89126918-89126940 CCTGCTCTGCCTACCTCACAGGG + Intronic
1028735471 7:94207078-94207100 TTAGCACTACTTATCTCACAGGG + Intergenic
1028982272 7:96979991-96980013 CCAACCCTGGCTATCTCAGATGG + Intergenic
1033266474 7:139891386-139891408 CTAGCCCGGCCAAACTCTCAGGG - Intronic
1036794740 8:11747286-11747308 CTGGCCCAGCCTGTCTCACGAGG + Intronic
1038287159 8:26215618-26215640 CTAGCCCTGGCTAATTCACATGG - Intergenic
1039697814 8:39931170-39931192 CTAGCCCTGCCTTATTCACAAGG + Intergenic
1041394590 8:57377622-57377644 CTAGGCCTGCCTCCCTCCCAAGG - Intergenic
1043391822 8:79799191-79799213 TTAGCCCTGCCCTTCTTACATGG + Intergenic
1043487155 8:80709630-80709652 CCAATCCTGCCTTTCTCACAGGG - Intronic
1043784707 8:84384217-84384239 CTTGCCCTACCCAGCTCACAGGG + Intronic
1044758339 8:95490364-95490386 AGATCCCTGCCTATGTCACAAGG - Intergenic
1045524649 8:102931261-102931283 CCTGCCCTGCCTGTCTCATAAGG - Intronic
1046159013 8:110334522-110334544 CTAGCCCAGACTTGCTCACATGG + Intergenic
1048236696 8:132698001-132698023 GCTTCCCTGCCTATCTCACAGGG - Intronic
1048368908 8:133759850-133759872 CAAACCATACCTATCTCACAGGG + Intergenic
1048445089 8:134487385-134487407 CTCACCCTGCCTTCCTCACAGGG - Intronic
1049051379 8:140199361-140199383 CTAGACCTTCCCACCTCACAGGG + Intronic
1049442757 8:142616770-142616792 CCAGCCCTGCCTTGCTCACCGGG - Intergenic
1050328617 9:4522432-4522454 CTATCCCTGCACATCTCACATGG + Intronic
1053410244 9:37911608-37911630 CTGACCCTGGCTCTCTCACAGGG + Intronic
1056083180 9:83118583-83118605 ATATCCCTGCATATCTCATATGG - Intergenic
1056299839 9:85229499-85229521 CAAGCTCTGCCCATCTCACTAGG + Intergenic
1057815192 9:98289249-98289271 CCTGTCCTGCCTACCTCACAAGG - Exonic
1057839270 9:98472354-98472376 CCTGCCCTGCTTATCTCATAGGG - Intronic
1059875233 9:118627517-118627539 CTGGCCCTGCCTTTGACACATGG + Intergenic
1186422448 X:9437150-9437172 CTAGCATTACCTCTCTCACAGGG - Intergenic
1186792428 X:13011992-13012014 CCTGCCCTGCCTATCTTGCAAGG + Intergenic
1187261898 X:17692547-17692569 CCAGCCCAGCCTCTCTCACTGGG - Intronic
1188062087 X:25613490-25613512 GTAGACCTGCTGATCTCACATGG - Intergenic
1188493994 X:30764569-30764591 CTAGCCCTGGCTTCTTCACATGG - Intergenic
1189106715 X:38244299-38244321 CGAGCCCAGCCTAGCTAACATGG + Intronic
1190407088 X:50098971-50098993 ATTGCCCTACCTACCTCACAGGG + Exonic
1190570867 X:51779927-51779949 CTGGCCCTGCCTACCTCTCCAGG + Intergenic
1192289346 X:69776327-69776349 CTGGCCCTGCCTTTGACACATGG - Intronic
1192433524 X:71128158-71128180 TCAGCCCTCCCTATCTCAGATGG - Intronic
1193151566 X:78129860-78129882 CCTACCCTGCCTACCTCACAGGG - Exonic
1194217750 X:91151803-91151825 CTGGCCCTGCCTATCTTACTAGG + Intergenic
1194314570 X:92359609-92359631 CTAGCCCTGTATATCTCAAATGG - Intronic
1195126347 X:101813100-101813122 CTAACCATGCCTTTCTCAGAAGG - Intergenic
1195179254 X:102340260-102340282 CTAACCATGCCTTTCTCAGAAGG + Intergenic
1195847197 X:109241418-109241440 CTTGCCTTGCCTGTCTCAGAAGG + Intergenic
1196917763 X:120556486-120556508 TTTGCCCTACCTGTCTCACAAGG - Intronic
1198608956 X:138375723-138375745 ATTGCACTGCCTACCTCACAGGG - Intergenic
1198742178 X:139852970-139852992 CTTGCCTTGCCTGTCCCACAAGG - Intronic
1199053501 X:143265212-143265234 ATAACCGTGACTATCTCACAGGG - Intergenic
1199413997 X:147558732-147558754 CTAGGTCTACCTATCTCACTAGG + Intergenic
1199424105 X:147681529-147681551 CCATCCCTGACTATCTCGCAGGG + Intergenic
1199973464 X:152877423-152877445 CTTGCCTTGCCTCTCTCACAGGG - Intergenic
1200554258 Y:4615599-4615621 CTGGCCCTGCCTATCTTACTAGG + Intergenic
1200622623 Y:5471132-5471154 CTAGCCCTGTATATCTCAAATGG - Intronic
1201584104 Y:15542033-15542055 CGAGACCAGCCTAGCTCACATGG - Intergenic