ID: 929331454

View in Genome Browser
Species Human (GRCh38)
Location 2:40686386-40686408
Sequence TGAGCCAGGGCACTCTTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929331454_929331457 17 Left 929331454 2:40686386-40686408 CCTTCTAAGAGTGCCCTGGCTCA No data
Right 929331457 2:40686426-40686448 CAGTGTGTCAAGAGAGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929331454 Original CRISPR TGAGCCAGGGCACTCTTAGA AGG (reversed) Intergenic
No off target data available for this crispr