ID: 929331455

View in Genome Browser
Species Human (GRCh38)
Location 2:40686399-40686421
Sequence AGTATAATGTAAATGAGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929331455_929331458 30 Left 929331455 2:40686399-40686421 CCCTGGCTCATTTACATTATACT No data
Right 929331458 2:40686452-40686474 TGCAAAGTCCTCTTGAAGCCTGG No data
929331455_929331457 4 Left 929331455 2:40686399-40686421 CCCTGGCTCATTTACATTATACT No data
Right 929331457 2:40686426-40686448 CAGTGTGTCAAGAGAGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929331455 Original CRISPR AGTATAATGTAAATGAGCCA GGG (reversed) Intergenic
No off target data available for this crispr