ID: 929331456

View in Genome Browser
Species Human (GRCh38)
Location 2:40686400-40686422
Sequence AAGTATAATGTAAATGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929331456_929331457 3 Left 929331456 2:40686400-40686422 CCTGGCTCATTTACATTATACTT No data
Right 929331457 2:40686426-40686448 CAGTGTGTCAAGAGAGAAAAAGG No data
929331456_929331458 29 Left 929331456 2:40686400-40686422 CCTGGCTCATTTACATTATACTT No data
Right 929331458 2:40686452-40686474 TGCAAAGTCCTCTTGAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929331456 Original CRISPR AAGTATAATGTAAATGAGCC AGG (reversed) Intergenic
No off target data available for this crispr