ID: 929331457

View in Genome Browser
Species Human (GRCh38)
Location 2:40686426-40686448
Sequence CAGTGTGTCAAGAGAGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929331454_929331457 17 Left 929331454 2:40686386-40686408 CCTTCTAAGAGTGCCCTGGCTCA No data
Right 929331457 2:40686426-40686448 CAGTGTGTCAAGAGAGAAAAAGG No data
929331455_929331457 4 Left 929331455 2:40686399-40686421 CCCTGGCTCATTTACATTATACT No data
Right 929331457 2:40686426-40686448 CAGTGTGTCAAGAGAGAAAAAGG No data
929331456_929331457 3 Left 929331456 2:40686400-40686422 CCTGGCTCATTTACATTATACTT No data
Right 929331457 2:40686426-40686448 CAGTGTGTCAAGAGAGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929331457 Original CRISPR CAGTGTGTCAAGAGAGAAAA AGG Intergenic
No off target data available for this crispr