ID: 929332346

View in Genome Browser
Species Human (GRCh38)
Location 2:40698005-40698027
Sequence CTGGATATTCAGCAAAGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929332341_929332346 13 Left 929332341 2:40697969-40697991 CCAAAAAGAAAAATGAGCAGTCT No data
Right 929332346 2:40698005-40698027 CTGGATATTCAGCAAAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929332346 Original CRISPR CTGGATATTCAGCAAAGAAG AGG Intergenic
No off target data available for this crispr