ID: 929333625

View in Genome Browser
Species Human (GRCh38)
Location 2:40713249-40713271
Sequence GAGGGTGAGCAGAAGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929333625_929333635 24 Left 929333625 2:40713249-40713271 CCATCCTGCTTCTGCTCACCCTC No data
Right 929333635 2:40713296-40713318 CAGTCCCATTGAGATAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929333625 Original CRISPR GAGGGTGAGCAGAAGCAGGA TGG (reversed) Intergenic
No off target data available for this crispr