ID: 929336622

View in Genome Browser
Species Human (GRCh38)
Location 2:40755565-40755587
Sequence CTGTGAATAAGAAACTACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929336622_929336623 -8 Left 929336622 2:40755565-40755587 CCTTGGTAGTTTCTTATTCACAG No data
Right 929336623 2:40755580-40755602 ATTCACAGTAACGATTTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929336622 Original CRISPR CTGTGAATAAGAAACTACCA AGG (reversed) Intergenic
No off target data available for this crispr