ID: 929337846

View in Genome Browser
Species Human (GRCh38)
Location 2:40772554-40772576
Sequence TCTTAGCCTGAGTAGGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929337846_929337849 1 Left 929337846 2:40772554-40772576 CCTGACACCTACTCAGGCTAAGA No data
Right 929337849 2:40772578-40772600 TTGGAAAAACCCATTTGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929337846 Original CRISPR TCTTAGCCTGAGTAGGTGTC AGG (reversed) Intergenic
No off target data available for this crispr