ID: 929342282

View in Genome Browser
Species Human (GRCh38)
Location 2:40835796-40835818
Sequence GGAGGGCAGTCAAGAACACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929342282_929342295 21 Left 929342282 2:40835796-40835818 CCCTGTGTTCTTGACTGCCCTCC No data
Right 929342295 2:40835840-40835862 CTGCTTTAGAAGGTGGAGGGAGG No data
929342282_929342291 11 Left 929342282 2:40835796-40835818 CCCTGTGTTCTTGACTGCCCTCC No data
Right 929342291 2:40835830-40835852 ATTTGTCACTCTGCTTTAGAAGG No data
929342282_929342292 14 Left 929342282 2:40835796-40835818 CCCTGTGTTCTTGACTGCCCTCC No data
Right 929342292 2:40835833-40835855 TGTCACTCTGCTTTAGAAGGTGG No data
929342282_929342296 27 Left 929342282 2:40835796-40835818 CCCTGTGTTCTTGACTGCCCTCC No data
Right 929342296 2:40835846-40835868 TAGAAGGTGGAGGGAGGCAGTGG No data
929342282_929342293 17 Left 929342282 2:40835796-40835818 CCCTGTGTTCTTGACTGCCCTCC No data
Right 929342293 2:40835836-40835858 CACTCTGCTTTAGAAGGTGGAGG No data
929342282_929342294 18 Left 929342282 2:40835796-40835818 CCCTGTGTTCTTGACTGCCCTCC No data
Right 929342294 2:40835837-40835859 ACTCTGCTTTAGAAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929342282 Original CRISPR GGAGGGCAGTCAAGAACACA GGG (reversed) Intergenic
No off target data available for this crispr