ID: 929342283

View in Genome Browser
Species Human (GRCh38)
Location 2:40835797-40835819
Sequence GGGAGGGCAGTCAAGAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929342283_929342292 13 Left 929342283 2:40835797-40835819 CCTGTGTTCTTGACTGCCCTCCC No data
Right 929342292 2:40835833-40835855 TGTCACTCTGCTTTAGAAGGTGG No data
929342283_929342294 17 Left 929342283 2:40835797-40835819 CCTGTGTTCTTGACTGCCCTCCC No data
Right 929342294 2:40835837-40835859 ACTCTGCTTTAGAAGGTGGAGGG No data
929342283_929342291 10 Left 929342283 2:40835797-40835819 CCTGTGTTCTTGACTGCCCTCCC No data
Right 929342291 2:40835830-40835852 ATTTGTCACTCTGCTTTAGAAGG No data
929342283_929342295 20 Left 929342283 2:40835797-40835819 CCTGTGTTCTTGACTGCCCTCCC No data
Right 929342295 2:40835840-40835862 CTGCTTTAGAAGGTGGAGGGAGG No data
929342283_929342293 16 Left 929342283 2:40835797-40835819 CCTGTGTTCTTGACTGCCCTCCC No data
Right 929342293 2:40835836-40835858 CACTCTGCTTTAGAAGGTGGAGG No data
929342283_929342296 26 Left 929342283 2:40835797-40835819 CCTGTGTTCTTGACTGCCCTCCC No data
Right 929342296 2:40835846-40835868 TAGAAGGTGGAGGGAGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929342283 Original CRISPR GGGAGGGCAGTCAAGAACAC AGG (reversed) Intergenic
No off target data available for this crispr