ID: 929342290

View in Genome Browser
Species Human (GRCh38)
Location 2:40835819-40835841
Sequence AGAGTGACAAATTCCAGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929342290_929342295 -2 Left 929342290 2:40835819-40835841 CCTGGACTGGAATTTGTCACTCT No data
Right 929342295 2:40835840-40835862 CTGCTTTAGAAGGTGGAGGGAGG No data
929342290_929342293 -6 Left 929342290 2:40835819-40835841 CCTGGACTGGAATTTGTCACTCT No data
Right 929342293 2:40835836-40835858 CACTCTGCTTTAGAAGGTGGAGG No data
929342290_929342296 4 Left 929342290 2:40835819-40835841 CCTGGACTGGAATTTGTCACTCT No data
Right 929342296 2:40835846-40835868 TAGAAGGTGGAGGGAGGCAGTGG No data
929342290_929342294 -5 Left 929342290 2:40835819-40835841 CCTGGACTGGAATTTGTCACTCT No data
Right 929342294 2:40835837-40835859 ACTCTGCTTTAGAAGGTGGAGGG No data
929342290_929342292 -9 Left 929342290 2:40835819-40835841 CCTGGACTGGAATTTGTCACTCT No data
Right 929342292 2:40835833-40835855 TGTCACTCTGCTTTAGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929342290 Original CRISPR AGAGTGACAAATTCCAGTCC AGG (reversed) Intergenic
No off target data available for this crispr