ID: 929342294

View in Genome Browser
Species Human (GRCh38)
Location 2:40835837-40835859
Sequence ACTCTGCTTTAGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929342288_929342294 -3 Left 929342288 2:40835817-40835839 CCCCTGGACTGGAATTTGTCACT No data
Right 929342294 2:40835837-40835859 ACTCTGCTTTAGAAGGTGGAGGG No data
929342287_929342294 0 Left 929342287 2:40835814-40835836 CCTCCCCTGGACTGGAATTTGTC No data
Right 929342294 2:40835837-40835859 ACTCTGCTTTAGAAGGTGGAGGG No data
929342290_929342294 -5 Left 929342290 2:40835819-40835841 CCTGGACTGGAATTTGTCACTCT No data
Right 929342294 2:40835837-40835859 ACTCTGCTTTAGAAGGTGGAGGG No data
929342283_929342294 17 Left 929342283 2:40835797-40835819 CCTGTGTTCTTGACTGCCCTCCC No data
Right 929342294 2:40835837-40835859 ACTCTGCTTTAGAAGGTGGAGGG No data
929342286_929342294 1 Left 929342286 2:40835813-40835835 CCCTCCCCTGGACTGGAATTTGT No data
Right 929342294 2:40835837-40835859 ACTCTGCTTTAGAAGGTGGAGGG No data
929342289_929342294 -4 Left 929342289 2:40835818-40835840 CCCTGGACTGGAATTTGTCACTC No data
Right 929342294 2:40835837-40835859 ACTCTGCTTTAGAAGGTGGAGGG No data
929342282_929342294 18 Left 929342282 2:40835796-40835818 CCCTGTGTTCTTGACTGCCCTCC No data
Right 929342294 2:40835837-40835859 ACTCTGCTTTAGAAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929342294 Original CRISPR ACTCTGCTTTAGAAGGTGGA GGG Intergenic
No off target data available for this crispr