ID: 929344709

View in Genome Browser
Species Human (GRCh38)
Location 2:40867218-40867240
Sequence GGTAGGGATTCTGTAGCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929344709_929344715 6 Left 929344709 2:40867218-40867240 CCAATAGCTACAGAATCCCTACC No data
Right 929344715 2:40867247-40867269 TAAGAAAAATATTATGTTTCAGG No data
929344709_929344716 7 Left 929344709 2:40867218-40867240 CCAATAGCTACAGAATCCCTACC No data
Right 929344716 2:40867248-40867270 AAGAAAAATATTATGTTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929344709 Original CRISPR GGTAGGGATTCTGTAGCTAT TGG (reversed) Intergenic
No off target data available for this crispr