ID: 929349202

View in Genome Browser
Species Human (GRCh38)
Location 2:40928062-40928084
Sequence ACATATATGGAAACACTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929349202_929349206 8 Left 929349202 2:40928062-40928084 CCCTCCAGTGTTTCCATATATGT No data
Right 929349206 2:40928093-40928115 CTTATGAATATATATTTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929349202 Original CRISPR ACATATATGGAAACACTGGA GGG (reversed) Intergenic
No off target data available for this crispr