ID: 929350320

View in Genome Browser
Species Human (GRCh38)
Location 2:40943063-40943085
Sequence ATGGATAAGAAGAAAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929350316_929350320 16 Left 929350316 2:40943024-40943046 CCCAGCAAAACTATTACTTTAAA No data
Right 929350320 2:40943063-40943085 ATGGATAAGAAGAAAGTGGAAGG No data
929350317_929350320 15 Left 929350317 2:40943025-40943047 CCAGCAAAACTATTACTTTAAAG No data
Right 929350320 2:40943063-40943085 ATGGATAAGAAGAAAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929350320 Original CRISPR ATGGATAAGAAGAAAGTGGA AGG Intergenic
No off target data available for this crispr