ID: 929353758

View in Genome Browser
Species Human (GRCh38)
Location 2:40994008-40994030
Sequence CCATCAAATAAGTGTTAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929353754_929353758 14 Left 929353754 2:40993971-40993993 CCTAGAGGCTTTTAAGAAAAGTA No data
Right 929353758 2:40994008-40994030 CCATCAAATAAGTGTTAAAAGGG No data
929353753_929353758 18 Left 929353753 2:40993967-40993989 CCATCCTAGAGGCTTTTAAGAAA No data
Right 929353758 2:40994008-40994030 CCATCAAATAAGTGTTAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929353758 Original CRISPR CCATCAAATAAGTGTTAAAA GGG Intergenic
No off target data available for this crispr