ID: 929354142

View in Genome Browser
Species Human (GRCh38)
Location 2:40999070-40999092
Sequence GTTCCGAAGGGGAAATTGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929354138_929354142 -2 Left 929354138 2:40999049-40999071 CCACTACACAAAGATAAAGTGGT No data
Right 929354142 2:40999070-40999092 GTTCCGAAGGGGAAATTGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929354142 Original CRISPR GTTCCGAAGGGGAAATTGAG CGG Intergenic
No off target data available for this crispr