ID: 929356359

View in Genome Browser
Species Human (GRCh38)
Location 2:41029443-41029465
Sequence CACTTCCACATTAAGATGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929356359_929356362 7 Left 929356359 2:41029443-41029465 CCTTACATCTTAATGTGGAAGTG No data
Right 929356362 2:41029473-41029495 AAAATAAATGGCTGGCACAGTGG No data
929356359_929356361 -1 Left 929356359 2:41029443-41029465 CCTTACATCTTAATGTGGAAGTG No data
Right 929356361 2:41029465-41029487 GAGAATTAAAAATAAATGGCTGG No data
929356359_929356360 -5 Left 929356359 2:41029443-41029465 CCTTACATCTTAATGTGGAAGTG No data
Right 929356360 2:41029461-41029483 AAGTGAGAATTAAAAATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929356359 Original CRISPR CACTTCCACATTAAGATGTA AGG (reversed) Intergenic
No off target data available for this crispr