ID: 929364712

View in Genome Browser
Species Human (GRCh38)
Location 2:41139824-41139846
Sequence ACTTTATGCTGTGATCTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929364712_929364717 8 Left 929364712 2:41139824-41139846 CCCTCAAGATCACAGCATAAAGT No data
Right 929364717 2:41139855-41139877 TTGTGGGCATGTTTGTGTACGGG No data
929364712_929364715 -8 Left 929364712 2:41139824-41139846 CCCTCAAGATCACAGCATAAAGT No data
Right 929364715 2:41139839-41139861 CATAAAGTTCAGATACTTGTGGG No data
929364712_929364714 -9 Left 929364712 2:41139824-41139846 CCCTCAAGATCACAGCATAAAGT No data
Right 929364714 2:41139838-41139860 GCATAAAGTTCAGATACTTGTGG No data
929364712_929364716 7 Left 929364712 2:41139824-41139846 CCCTCAAGATCACAGCATAAAGT No data
Right 929364716 2:41139854-41139876 CTTGTGGGCATGTTTGTGTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929364712 Original CRISPR ACTTTATGCTGTGATCTTGA GGG (reversed) Intergenic